EMAIL THIS PAGE TO A FRIEND

PAPOLA

poly(A) polymerase alpha

209 Gene Product Result for
Synonyms: PAP
UniProtKB ID: P51003, Q86SX4, Q86TV0, Q8IYF5, Q9BVU2
Gene ID:
Human(10914) Summary: The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(18789) poly (A) polymerase alpha
Rat(314417) poly (A) polymerase alpha
Zebrafish(404041) poly(A) polymerase alpha
chicken(395878) poly(A) polymerase alpha
dog(480430) poly(A) polymerase alpha
cow(338051) poly(A) polymerase alpha
domestic cat(101083345) poly(A) polymerase alpha
sheep(101122058) poly(A) polymerase alpha
naked mole-rat(101714424) poly(A) polymerase alpha
domestic guinea pig(100728101) poly(A) polymerase alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032632 Rosetta Predictions human pricing
NM_001108056 Rosetta Predictions rat pricing
NM_011112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360184 predicted 1062
2 SASI_Hs01_00026872 predicted 2132
3 SASI_Hs01_00026874 predicted 1170
4 SASI_Hs01_00026875 predicted 571
5 SASI_Hs02_00360185 predicted 1622
6 SASI_Hs01_00026876 predicted 660
7 SASI_Hs01_00026877 predicted 1844
8 SASI_Hs01_00026878 predicted 1746
9 SASI_Hs01_00026879 predicted 2289
10 SASI_Hs01_00026880 predicted 2220
11 SASI_Hs01_00026871 predicted 2366
12 SASI_Hs01_00026873 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234915 predicted 652
2 SASI_Rn02_00234916 predicted 994
3 SASI_Rn02_00234917 predicted 1159
4 SASI_Rn02_00234918 predicted 1732
5 SASI_Rn02_00234919 predicted 1907
6 SASI_Rn02_00234920 predicted 2115
7 SASI_Rn02_00234921 predicted 1784
8 SASI_Rn02_00234922 predicted 1601
9 SASI_Rn02_00234923 predicted 1830
10 SASI_Rn02_00234924 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319930 predicted 262
2 SASI_Mm01_00040945 predicted 1303
3 SASI_Mm01_00040946 predicted 654
4 SASI_Mm01_00040947 predicted 1000
5 SASI_Mm01_00040948 predicted 412
6 SASI_Mm01_00040950 predicted 594
7 SASI_Mm01_00040951 predicted 1781
8 SASI_Mm02_00319931 predicted 1582
9 SASI_Mm01_00040952 predicted 1823
10 SASI_Mm01_00040953 predicted 795
11 SASI_Mm01_00040944 predicted 661
12 SASI_Mm01_00040949 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032632
VALIDATED
PAPOLA MISSION shRNA Bacterial Glycerol Stock
poly(A) polymerase alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-652s21c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-317s21c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1139s21c1
Sequence:CCGGACCATCTTATGCCTATAATTACTCGAGTAATTATAGGCATAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1903s21c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-2622s21c1
Sequence:CCGGTGAAGCCAGGAGTACTATTATCTCGAGATAATAGTACTCCTGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-654s1c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-1186s1c1
Sequence:CCGGCCACGTACAATGTGTCCGTTTCTCGAGAAACGGACACATTGTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-888s1c1
Sequence:CCGGGCTATCAAACTATGGGCCAAACTCGAGTTTGGCCCATAGTTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-1905s1c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-319s1c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032632
VALIDATED
PAPOLA MISSION shRNA shRNA Plasmid DNA
poly(A) polymerase alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-652s21c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-317s21c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1139s21c1
Sequence:CCGGACCATCTTATGCCTATAATTACTCGAGTAATTATAGGCATAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1903s21c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-2622s21c1
Sequence:CCGGTGAAGCCAGGAGTACTATTATCTCGAGATAATAGTACTCCTGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-654s1c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-1186s1c1
Sequence:CCGGCCACGTACAATGTGTCCGTTTCTCGAGAAACGGACACATTGTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-888s1c1
Sequence:CCGGGCTATCAAACTATGGGCCAAACTCGAGTTTGGCCCATAGTTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-1905s1c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-319s1c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032632
VALIDATED
PAPOLA MISSION shRNA Lentiviral Transduction Particles
poly(A) polymerase alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-652s21c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-317s21c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1139s21c1
Sequence:CCGGACCATCTTATGCCTATAATTACTCGAGTAATTATAGGCATAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-1903s21c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032632.3-2622s21c1
Sequence:CCGGTGAAGCCAGGAGTACTATTATCTCGAGATAATAGTACTCCTGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-654s1c1
Sequence:CCGGGCTGTTGAAGAGGCATTCGTACTCGAGTACGAATGCCTCTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-1186s1c1
Sequence:CCGGCCACGTACAATGTGTCCGTTTCTCGAGAAACGGACACATTGTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032632.2-888s1c1
Sequence:CCGGGCTATCAAACTATGGGCCAAACTCGAGTTTGGCCCATAGTTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-1905s1c1
Sequence:CCGGGCAGCATCTGTGACCAACATACTCGAGTATGTTGGTCACAGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032632.2-319s1c1
Sequence:CCGGGCGTACTTACACAGAAACTAACTCGAGTTAGTTTCTGTGTAAGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011112
VALIDATED
PAPOLA MISSION shRNA Bacterial Glycerol Stock
poly(A) polymerase alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-814s21c1
Sequence:CCGGTTGCAGGGTAACCGATGAAATCTCGAGATTTCATCGGTTACCCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-653s21c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1742s21c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1061s21c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-2623s21c1
Sequence:CCGGGCGAAGCCAGGAGTGCTATTACTCGAGTAATAGCACTCCTGGCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-856s1c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-448s1c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-1537s1c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011112.1-1526s1c2
Sequence:CCGGCAACAGAAGGAGTCAAGTTAACTCGAGTTAACTTGACTCCTTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011112
VALIDATED
PAPOLA MISSION shRNA shRNA Plasmid DNA
poly(A) polymerase alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-814s21c1
Sequence:CCGGTTGCAGGGTAACCGATGAAATCTCGAGATTTCATCGGTTACCCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-653s21c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1742s21c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1061s21c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-2623s21c1
Sequence:CCGGGCGAAGCCAGGAGTGCTATTACTCGAGTAATAGCACTCCTGGCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-856s1c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-448s1c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-1537s1c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011112.1-1526s1c2
Sequence:CCGGCAACAGAAGGAGTCAAGTTAACTCGAGTTAACTTGACTCCTTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011112
VALIDATED
PAPOLA MISSION shRNA Lentiviral Transduction Particles
poly(A) polymerase alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-814s21c1
Sequence:CCGGTTGCAGGGTAACCGATGAAATCTCGAGATTTCATCGGTTACCCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-653s21c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1742s21c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-1061s21c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011112.3-2623s21c1
Sequence:CCGGGCGAAGCCAGGAGTGCTATTACTCGAGTAATAGCACTCCTGGCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-856s1c1
Sequence:CCGGCTATTGAAACAGCCTGAAGAACTCGAGTTCTTCAGGCTGTTTCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-448s1c1
Sequence:CCGGGAAGAGGCATTTGTACCAGTTCTCGAGAACTGGTACAAATGCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011112.1-1537s1c1
Sequence:CCGGGTCAAGTTAACAGCTCTGAATCTCGAGATTCAGAGCTGTTAACTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011112.1-1526s1c2
Sequence:CCGGCAACAGAAGGAGTCAAGTTAACTCGAGTTAACTTGACTCCTTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)