EMAIL THIS PAGE TO A FRIEND

PAPOLG

poly(A) polymerase gamma

154 Gene Product Result for
UniProtKB ID: Q9BWT3, B2RBH4, Q969N1, Q9H8L2, Q9HAD0
Gene ID:
Human(64895) Summary: This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Mouse(216578) poly(A) polymerase gamma
Rat(305586) poly(A) polymerase gamma
Zebrafish(393593) poly(A) polymerase gamma
chicken(100857196) poly(A) polymerase gamma
cow(529071) poly(A) polymerase gamma
domestic cat(101082998) poly(A) polymerase gamma
dog(481382) poly(A) polymerase gamma
sheep(101118860) poly(A) polymerase gamma
domestic guinea pig(100719679) poly(A) polymerase gamma
naked mole-rat(101701248) poly(A) polymerase gamma
Domestic Rabbit(100344714) poly(A) polymerase gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022894 Rosetta Predictions human pricing
NM_001107244 Rosetta Predictions rat pricing
NM_172555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051308 predicted 2298
2 SASI_Hs01_00051309 predicted 1182
3 SASI_Hs02_00356178 predicted 2305
4 SASI_Hs01_00051310 predicted 1525
5 SASI_Hs01_00051311 predicted 1099
6 SASI_Hs01_00051313 predicted 1515
7 SASI_Hs01_00051314 predicted 1134
8 SASI_Hs01_00051315 predicted 2456
9 SASI_Hs01_00051316 predicted 981
10 SASI_Hs02_00356179 predicted 891
11 SASI_Hs01_00051312 predicted 1019
12 SASI_Hs01_00051317 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226925 predicted 2393
2 SASI_Rn02_00226926 predicted 548
3 SASI_Rn02_00226927 predicted 2124
4 SASI_Rn02_00226928 predicted 1675
5 SASI_Rn02_00226929 predicted 1192
6 SASI_Rn02_00226930 predicted 1524
7 SASI_Rn02_00226931 predicted 710
8 SASI_Rn02_00226932 predicted 1035
9 SASI_Rn02_00226933 predicted 802
10 SASI_Rn02_00226934 predicted 2130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125037 predicted 2380
2 SASI_Mm01_00125038 predicted 533
3 SASI_Mm01_00125040 predicted 2108
4 SASI_Mm01_00125041 predicted 1564
5 SASI_Mm01_00125042 predicted 1286
6 SASI_Mm01_00125044 predicted 454
7 SASI_Mm01_00125045 predicted 2305
8 SASI_Mm01_00125046 predicted 695
9 SASI_Mm02_00344184 predicted 1485
10 SASI_Mm02_00344185 predicted 713
11 SASI_Mm01_00125039 predicted 1514
12 SASI_Mm01_00125043 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022894
VALIDATED
PAPOLG MISSION shRNA Bacterial Glycerol Stock
poly(A) polymerase gamma
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c1
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-2117s1c1
Sequence:CCGGCGCATCTGAATGGAATGTCAACTCGAGTTGACATTCCATTCAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-1132s1c1
Sequence:CCGGCCTCGGGTAAATCCATCAGATCTCGAGATCTGATGGATTTACCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-1217s1c1
Sequence:CCGGCCACATCAACTCGAACAGTAACTCGAGTTACTGTTCGAGTTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-2350s1c1
Sequence:CCGGCCCAGTAAAGAACTACCAGATCTCGAGATCTGGTAGTTCTTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022894.2-2306s21c1
Sequence:GTACCGGCTATGCCTATTCCAACTATTGCTCGAGCAATAGTTGGAATAGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c2
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-3115s21c1
Sequence:CCGGTAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-2224s21c1
Sequence:CCGGATTCGACTTGAATCAACATTTCTCGAGAAATGTTGATTCAAGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1534s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1308s21c1
Sequence:CCGGACTACTTGAGCCACCGAATTTCTCGAGAAATTCGGTGGCTCAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022894
VALIDATED
PAPOLG MISSION shRNA shRNA Plasmid DNA
poly(A) polymerase gamma
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c1
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-2117s1c1
Sequence:CCGGCGCATCTGAATGGAATGTCAACTCGAGTTGACATTCCATTCAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-1132s1c1
Sequence:CCGGCCTCGGGTAAATCCATCAGATCTCGAGATCTGATGGATTTACCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-1217s1c1
Sequence:CCGGCCACATCAACTCGAACAGTAACTCGAGTTACTGTTCGAGTTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-2350s1c1
Sequence:CCGGCCCAGTAAAGAACTACCAGATCTCGAGATCTGGTAGTTCTTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022894.2-2306s21c1
Sequence:GTACCGGCTATGCCTATTCCAACTATTGCTCGAGCAATAGTTGGAATAGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c2
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-3115s21c1
Sequence:CCGGTAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-2224s21c1
Sequence:CCGGATTCGACTTGAATCAACATTTCTCGAGAAATGTTGATTCAAGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1534s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1308s21c1
Sequence:CCGGACTACTTGAGCCACCGAATTTCTCGAGAAATTCGGTGGCTCAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022894
VALIDATED
PAPOLG MISSION shRNA Lentiviral Transduction Particles
poly(A) polymerase gamma
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c1
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-2117s1c1
Sequence:CCGGCGCATCTGAATGGAATGTCAACTCGAGTTGACATTCCATTCAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-1132s1c1
Sequence:CCGGCCTCGGGTAAATCCATCAGATCTCGAGATCTGATGGATTTACCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-1217s1c1
Sequence:CCGGCCACATCAACTCGAACAGTAACTCGAGTTACTGTTCGAGTTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022894.2-2350s1c1
Sequence:CCGGCCCAGTAAAGAACTACCAGATCTCGAGATCTGGTAGTTCTTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022894.2-2306s21c1
Sequence:GTACCGGCTATGCCTATTCCAACTATTGCTCGAGCAATAGTTGGAATAGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022894.2-487s1c2
Sequence:CCGGCCTTCTGTTGTGGCTACTGTTCTCGAGAACAGTAGCCACAACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-3115s21c1
Sequence:CCGGTAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-2224s21c1
Sequence:CCGGATTCGACTTGAATCAACATTTCTCGAGAAATGTTGATTCAAGTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1534s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022894.2-1308s21c1
Sequence:CCGGACTACTTGAGCCACCGAATTTCTCGAGAAATTCGGTGGCTCAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172555
VALIDATED
PAPOLG MISSION shRNA Bacterial Glycerol Stock
poly(A) polymerase gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-348s21c1
Sequence:CCGGATGAAGCCATTTGGAGTATTTCTCGAGAAATACTCCAAATGGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172555.1-3115s21c1
Sequence:CCGGCAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172555.1-902s21c1
Sequence:CCGGGGCAAAGCGCCGTGGTATTTACTCGAGTAAATACCACGGCGCTTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1518s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1107s21c1
Sequence:CCGGGTCTGGGATCCTCGGGTAAATCTCGAGATTTACCCGAGGATCCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172555
VALIDATED
PAPOLG MISSION shRNA shRNA Plasmid DNA
poly(A) polymerase gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-348s21c1
Sequence:CCGGATGAAGCCATTTGGAGTATTTCTCGAGAAATACTCCAAATGGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172555.1-3115s21c1
Sequence:CCGGCAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172555.1-902s21c1
Sequence:CCGGGGCAAAGCGCCGTGGTATTTACTCGAGTAAATACCACGGCGCTTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1518s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1107s21c1
Sequence:CCGGGTCTGGGATCCTCGGGTAAATCTCGAGATTTACCCGAGGATCCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172555
VALIDATED
PAPOLG MISSION shRNA Lentiviral Transduction Particles
poly(A) polymerase gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-348s21c1
Sequence:CCGGATGAAGCCATTTGGAGTATTTCTCGAGAAATACTCCAAATGGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172555.1-3115s21c1
Sequence:CCGGCAAGAGTTGGGCACCATAAATCTCGAGATTTATGGTGCCCAACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172555.1-902s21c1
Sequence:CCGGGGCAAAGCGCCGTGGTATTTACTCGAGTAAATACCACGGCGCTTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1518s21c1
Sequence:CCGGATGTGGTTCCTTGGGATAATTCTCGAGAATTATCCCAAGGAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172555.1-1107s21c1
Sequence:CCGGGTCTGGGATCCTCGGGTAAATCTCGAGATTTACCCGAGGATCCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)