EMAIL THIS PAGE TO A FRIEND

PAPPA

pregnancy-associated plasma protein A, pappalysin 1

223 Gene Product Result for
Synonyms: ASBABP2 DIPLA1 IGFBP-4ase PAPA PAPP-A PAPPA1
UniProtKB ID: Q13219, B1AMF9, Q08371, Q68G52, Q9UDK7
Gene ID:
Human(5069) Summary: This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
Mouse(18491) pregnancy-associated plasma protein A
Rat(313262) pregnancy-associated plasma protein A
chicken(417245) pregnancy-associated plasma protein A, pappalysin 1
cow(282647) pregnancy-associated plasma protein A, pappalysin 1
domestic cat(101089154) pregnancy-associated plasma protein A, pappalysin 1
dog(481692) pregnancy-associated plasma protein A, pappalysin 1
naked mole-rat(101725271) pregnancy-associated plasma protein A, pappalysin 1
domestic guinea pig(100734958) pregnancy-associated plasma protein A, pappalysin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0720 Human PAPPA / Pappalysin-1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_131437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002581 Rosetta Predictions human pricing
NM_001107939 Rosetta Predictions rat pricing
NM_021362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108063 predicted 3396
2 SASI_Hs01_00108065 predicted 3307
3 SASI_Hs01_00108066 predicted 4661
4 SASI_Hs01_00108067 predicted 3106
5 SASI_Hs01_00108068 predicted 3134
6 SASI_Hs01_00108069 predicted 4668
7 SASI_Hs01_00108070 predicted 3074
8 SASI_Hs02_00334078 predicted 1076
9 SASI_Hs01_00108071 predicted 3809
10 SASI_Hs01_00108072 predicted 2289
11 SASI_Hs01_00108064 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233775 predicted 2911
2 SASI_Rn02_00233776 predicted 1082
3 SASI_Rn02_00233777 predicted 1312
4 SASI_Rn02_00233778 predicted 2468
5 SASI_Rn02_00233779 predicted 3774
6 SASI_Rn02_00233780 predicted 4514
7 SASI_Rn02_00233781 predicted 1823
8 SASI_Rn02_00233782 predicted 1780
9 SASI_Rn02_00233783 predicted 490
10 SASI_Rn02_00233784 predicted 3086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046893 predicted 1877
2 SASI_Mm01_00046894 predicted 4888
3 SASI_Mm01_00046895 predicted 3567
4 SASI_Mm01_00046896 predicted 3167
5 SASI_Mm01_00046897 predicted 961
6 SASI_Mm01_00046898 predicted 1146
7 SASI_Mm01_00046899 predicted 1967
8 SASI_Mm02_00325951 predicted 775
9 SASI_Mm01_00046901 predicted 2479
10 SASI_Mm01_00046902 predicted 1940
11 SASI_Mm01_00046900 predicted 4027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002581
PAPPA MISSION shRNA Bacterial Glycerol Stock
pregnancy-associated plasma protein A, pappalysin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3125s21c1
Sequence:CCGGTTGGCAGTGTGTACCAGTATTCTCGAGAATACTGGTACACACTGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-1045s21c1
Sequence:CCGGGAACAAGTGGGTGGCATATTCCTCGAGGAATATGCCACCCACTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3690s21c1
Sequence:CCGGGGTGACGGATGGGACATATTACTCGAGTAATATGTCCCATCCGTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3263s21c1
Sequence:CCGGACGACATGAATAAGATCAATGCTCGAGCATTGATCTTATTCATGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-1362s1c1
Sequence:CCGGCGGACAGACATTGTGTGACAACTCGAGTTGTCACACAATGTCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-798s1c1
Sequence:CCGGGCTGTATGACAAATGTTCTTACTCGAGTAAGAACATTTGTCATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-5164s1c1
Sequence:CCGGCCATTCCCTATGTCCTGTGATCTCGAGATCACAGGACATAGGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-2477s1c1
Sequence:CCGGGCCATTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-3084s1c1
Sequence:CCGGCCTACATCTCAATAGGAAATTCTCGAGAATTTCCTATTGAGATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002581
PAPPA MISSION shRNA shRNA Plasmid DNA
pregnancy-associated plasma protein A, pappalysin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3125s21c1
Sequence:CCGGTTGGCAGTGTGTACCAGTATTCTCGAGAATACTGGTACACACTGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-1045s21c1
Sequence:CCGGGAACAAGTGGGTGGCATATTCCTCGAGGAATATGCCACCCACTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3690s21c1
Sequence:CCGGGGTGACGGATGGGACATATTACTCGAGTAATATGTCCCATCCGTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3263s21c1
Sequence:CCGGACGACATGAATAAGATCAATGCTCGAGCATTGATCTTATTCATGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-1362s1c1
Sequence:CCGGCGGACAGACATTGTGTGACAACTCGAGTTGTCACACAATGTCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-798s1c1
Sequence:CCGGGCTGTATGACAAATGTTCTTACTCGAGTAAGAACATTTGTCATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-5164s1c1
Sequence:CCGGCCATTCCCTATGTCCTGTGATCTCGAGATCACAGGACATAGGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-2477s1c1
Sequence:CCGGGCCATTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-3084s1c1
Sequence:CCGGCCTACATCTCAATAGGAAATTCTCGAGAATTTCCTATTGAGATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002581
PAPPA MISSION shRNA Lentiviral Transduction Particles
pregnancy-associated plasma protein A, pappalysin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3125s21c1
Sequence:CCGGTTGGCAGTGTGTACCAGTATTCTCGAGAATACTGGTACACACTGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-1045s21c1
Sequence:CCGGGAACAAGTGGGTGGCATATTCCTCGAGGAATATGCCACCCACTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3690s21c1
Sequence:CCGGGGTGACGGATGGGACATATTACTCGAGTAATATGTCCCATCCGTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002581.3-3263s21c1
Sequence:CCGGACGACATGAATAAGATCAATGCTCGAGCATTGATCTTATTCATGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-1362s1c1
Sequence:CCGGCGGACAGACATTGTGTGACAACTCGAGTTGTCACACAATGTCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-798s1c1
Sequence:CCGGGCTGTATGACAAATGTTCTTACTCGAGTAAGAACATTTGTCATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-5164s1c1
Sequence:CCGGCCATTCCCTATGTCCTGTGATCTCGAGATCACAGGACATAGGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-2477s1c1
Sequence:CCGGGCCATTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002581.3-3084s1c1
Sequence:CCGGCCTACATCTCAATAGGAAATTCTCGAGAATTTCCTATTGAGATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021362
VALIDATED
PAPPA MISSION shRNA Bacterial Glycerol Stock
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3119s21c1
Sequence:CCGGGTACCGGATTATCACCATTTCCTCGAGGAAATGGTGATAATCCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-1023s21c1
Sequence:CCGGGAGCAAGTAGGTGGCATATTCCTCGAGGAATATGCCACCTACTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021362.1-2629s21c1
Sequence:CCGGTCCGAACCTGGAGTCCAAATTCTCGAGAATTTGGACTCCAGGTTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3241s21c1
Sequence:CCGGACGACATGAATAAGGTCAATGCTCGAGCATTGACCTTATTCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3314s21c1
Sequence:CCGGTGAACCCAGCCGGTGCTATTTCTCGAGAAATAGCACCGGCTGGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021362
VALIDATED
PAPPA MISSION shRNA shRNA Plasmid DNA
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3119s21c1
Sequence:CCGGGTACCGGATTATCACCATTTCCTCGAGGAAATGGTGATAATCCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-1023s21c1
Sequence:CCGGGAGCAAGTAGGTGGCATATTCCTCGAGGAATATGCCACCTACTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021362.1-2629s21c1
Sequence:CCGGTCCGAACCTGGAGTCCAAATTCTCGAGAATTTGGACTCCAGGTTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3241s21c1
Sequence:CCGGACGACATGAATAAGGTCAATGCTCGAGCATTGACCTTATTCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3314s21c1
Sequence:CCGGTGAACCCAGCCGGTGCTATTTCTCGAGAAATAGCACCGGCTGGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021362
VALIDATED
PAPPA MISSION shRNA Lentiviral Transduction Particles
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3119s21c1
Sequence:CCGGGTACCGGATTATCACCATTTCCTCGAGGAAATGGTGATAATCCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-1023s21c1
Sequence:CCGGGAGCAAGTAGGTGGCATATTCCTCGAGGAATATGCCACCTACTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021362.1-2629s21c1
Sequence:CCGGTCCGAACCTGGAGTCCAAATTCTCGAGAATTTGGACTCCAGGTTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3241s21c1
Sequence:CCGGACGACATGAATAAGGTCAATGCTCGAGCATTGACCTTATTCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021362.1-3314s21c1
Sequence:CCGGTGAACCCAGCCGGTGCTATTTCTCGAGAAATAGCACCGGCTGGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131437
VALIDATED
PAPPA MISSION shRNA Bacterial Glycerol Stock
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2051s1c1
Sequence:CCGGGCCACTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-483s1c1
Sequence:CCGGGCGGCTGATGAAGCTCTATATCTCGAGATATAGAGCTTCATCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-2538s1c1
Sequence:CCGGCCTGGAGATTGATGCAGCAATCTCGAGATTGCTGCATCAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2307s1c1
Sequence:CCGGGCTGGAATTTCGCTACCCTTTCTCGAGAAAGGGTAGCGAAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-884s1c1
Sequence:CCGGCCAGTTACAATCAGCTCCCAACTCGAGTTGGGAGCTGATTGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131437
VALIDATED
PAPPA MISSION shRNA shRNA Plasmid DNA
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2051s1c1
Sequence:CCGGGCCACTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-483s1c1
Sequence:CCGGGCGGCTGATGAAGCTCTATATCTCGAGATATAGAGCTTCATCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-2538s1c1
Sequence:CCGGCCTGGAGATTGATGCAGCAATCTCGAGATTGCTGCATCAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2307s1c1
Sequence:CCGGGCTGGAATTTCGCTACCCTTTCTCGAGAAAGGGTAGCGAAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-884s1c1
Sequence:CCGGCCAGTTACAATCAGCTCCCAACTCGAGTTGGGAGCTGATTGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131437
VALIDATED
PAPPA MISSION shRNA Lentiviral Transduction Particles
pregnancy-associated plasma protein A, pappalysin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2051s1c1
Sequence:CCGGGCCACTTCTTTGAAAGAGAATCTCGAGATTCTCTTTCAAAGAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-483s1c1
Sequence:CCGGGCGGCTGATGAAGCTCTATATCTCGAGATATAGAGCTTCATCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131437.4-2538s1c1
Sequence:CCGGCCTGGAGATTGATGCAGCAATCTCGAGATTGCTGCATCAATCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-2307s1c1
Sequence:CCGGGCTGGAATTTCGCTACCCTTTCTCGAGAAAGGGTAGCGAAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131437.4-884s1c1
Sequence:CCGGCCAGTTACAATCAGCTCCCAACTCGAGTTGGGAGCTGATTGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)