EMAIL THIS PAGE TO A FRIEND

PAPSS1

3'-phosphoadenosine 5'-phosphosulfate synthase 1

90 Gene Product Result for
Synonyms: ATPSK1 PAPSS SK1
Gene ID:
Human(9061) Summary: Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]
Mouse(23971) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Rat(295443) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Zebrafish(559488) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
domestic cat(101088837) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
cow(504439) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Horse(100072985) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
dog(478504) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
chicken(422530) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
sheep(101123377) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
naked mole-rat(101714839) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
domestic guinea pig(100135593) 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304831 ANTI-PAPSS1 (C-TERM A607) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1305044 ANTI-PAPSS1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1305064 ANTI-PAPSS1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB1304830 ANTI-PAPSS1 (N-TERM K9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1303596 ANTI-PAPSS1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2700354 Anti-PAPSS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2700365 Anti-PAPSS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2700269 Anti-PAPSS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA049781 Anti-PAPSS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0009061M5 Monoclonal Anti-PAPSS1 antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005443 Rosetta Predictions human pricing
NM_001106471 Rosetta Predictions rat pricing
NM_011863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150592 predicted 1285
2 SASI_Hs02_00339599 predicted 433
3 SASI_Hs01_00150593 predicted 1256
4 SASI_Hs02_00339600 predicted 835
5 SASI_Hs01_00150594 predicted 1267
6 SASI_Hs01_00150595 predicted 318
7 SASI_Hs01_00150596 predicted 716
8 SASI_Hs02_00339601 predicted 789
9 SASI_Hs01_00150597 predicted 980
10 SASI_Hs02_00339602 predicted 229
11 SASI_Hs01_00150598 predicted 495
12 SASI_Hs01_00150599 predicted 1054
13 SASI_Hs01_00150600 predicted 1213
14 SASI_Hs01_00150601 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219288 predicted 1202
2 SASI_Rn02_00219289 predicted 1783
3 SASI_Rn02_00219290 predicted 766
4 SASI_Rn02_00219291 predicted 1057
5 SASI_Rn02_00219292 predicted 1140
6 SASI_Rn02_00219293 predicted 1318
7 SASI_Rn02_00219294 predicted 771
8 SASI_Rn02_00219295 predicted 311
9 SASI_Rn02_00219296 predicted 1671
10 SASI_Rn02_00219297 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321626 predicted 380
2 SASI_Mm02_00321627 predicted 1883
3 SASI_Mm02_00321628 predicted 742
4 SASI_Mm02_00321629 predicted 1419
5 SASI_Mm02_00321630 predicted 736
6 SASI_Mm02_00321631 predicted 1154
7 SASI_Mm02_00321632 predicted 1189
8 SASI_Mm02_00321633 predicted 406
9 SASI_Mm02_00321634 predicted 459
10 SASI_Mm02_00321635 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005443
VALIDATED
PAPSS1 MISSION shRNA Bacterial Glycerol Stock
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005443.4-2269s21c1
Sequence:GTACCGGACCAGTAGTATTCACATTAAACTCGAGTTTAATGTGAATACTACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-517s21c1
Sequence:CCGGATTCATGAAGGTGCAAGTTTACTCGAGTAAACTTGCACCTTCATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1548s21c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1177s1c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-779s1c1
Sequence:CCGGGGAAACATTACCAGCACTGAACTCGAGTTCAGTGCTGGTAATGTTTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-355s21c1
Sequence:GTACCGGATTCGTCAAGGTCTCAATAAACTCGAGTTTATTGAGACCTTGACGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-921s1c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1490s1c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1235s21c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-979s21c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005443
VALIDATED
PAPSS1 MISSION shRNA shRNA Plasmid DNA
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005443.4-2269s21c1
Sequence:GTACCGGACCAGTAGTATTCACATTAAACTCGAGTTTAATGTGAATACTACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-517s21c1
Sequence:CCGGATTCATGAAGGTGCAAGTTTACTCGAGTAAACTTGCACCTTCATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1548s21c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1177s1c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-779s1c1
Sequence:CCGGGGAAACATTACCAGCACTGAACTCGAGTTCAGTGCTGGTAATGTTTCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-355s21c1
Sequence:GTACCGGATTCGTCAAGGTCTCAATAAACTCGAGTTTATTGAGACCTTGACGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-921s1c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1490s1c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1235s21c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-979s21c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005443
VALIDATED
PAPSS1 MISSION shRNA Lentiviral Transduction Particles
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005443.4-2269s21c1
Sequence:GTACCGGACCAGTAGTATTCACATTAAACTCGAGTTTAATGTGAATACTACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-517s21c1
Sequence:CCGGATTCATGAAGGTGCAAGTTTACTCGAGTAAACTTGCACCTTCATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1548s21c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1177s1c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-779s1c1
Sequence:CCGGGGAAACATTACCAGCACTGAACTCGAGTTCAGTGCTGGTAATGTTTCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-355s21c1
Sequence:GTACCGGATTCGTCAAGGTCTCAATAAACTCGAGTTTATTGAGACCTTGACGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-921s1c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005443.x-1490s1c1
Sequence:CCGGGGCCATCTTCCCATCTCCCATCTCGAGATGGGAGATGGGAAGATGGCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-1235s21c1
Sequence:CCGGTGGATCGAGTTTATTGGAATGCTCGAGCATTCCAATAAACTCGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005443.4-979s21c1
Sequence:CCGGGGAGGTGTCATTAACTTGTCACTCGAGTGACAAGTTAATGACACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011863
VALIDATED
PAPSS1 MISSION shRNA Bacterial Glycerol Stock
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.2-1086s21c1
Sequence:CCGGGACAGCTACGCACGAGGATAACTCGAGTTATCCTCGTGCGTAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011863.1-2173s21c3
Sequence:CCGGTATGCTTCTGTCTTACAATTTCTCGAGAAATTGTAAGACAGAAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1770s21c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-936s21c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-303s21c1
Sequence:CCGGCATCCGCCAAGGACTCAATAACTCGAGTTATTGAGTCCTTGGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1186s21c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1770s1c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011863.1-936s1c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-417s1c1
Sequence:CCGGCACCAGCTTTATATCGCCTTACTCGAGTAAGGCGATATAAAGCTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1186s1c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-106s1c1
Sequence:CCGGGCAACCAACGTCACCTATCAACTCGAGTTGATAGGTGACGTTGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011863
VALIDATED
PAPSS1 MISSION shRNA shRNA Plasmid DNA
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.2-1086s21c1
Sequence:CCGGGACAGCTACGCACGAGGATAACTCGAGTTATCCTCGTGCGTAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011863.1-2173s21c3
Sequence:CCGGTATGCTTCTGTCTTACAATTTCTCGAGAAATTGTAAGACAGAAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1770s21c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-936s21c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-303s21c1
Sequence:CCGGCATCCGCCAAGGACTCAATAACTCGAGTTATTGAGTCCTTGGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1186s21c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1770s1c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011863.1-936s1c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-417s1c1
Sequence:CCGGCACCAGCTTTATATCGCCTTACTCGAGTAAGGCGATATAAAGCTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1186s1c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-106s1c1
Sequence:CCGGGCAACCAACGTCACCTATCAACTCGAGTTGATAGGTGACGTTGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011863
VALIDATED
PAPSS1 MISSION shRNA Lentiviral Transduction Particles
3'-phosphoadenosine 5'-phosphosulfate synthase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.2-1086s21c1
Sequence:CCGGGACAGCTACGCACGAGGATAACTCGAGTTATCCTCGTGCGTAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011863.1-2173s21c3
Sequence:CCGGTATGCTTCTGTCTTACAATTTCTCGAGAAATTGTAAGACAGAAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1770s21c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-936s21c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-303s21c1
Sequence:CCGGCATCCGCCAAGGACTCAATAACTCGAGTTATTGAGTCCTTGGCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011863.1-1186s21c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1770s1c1
Sequence:CCGGCCACGAAGACTTCGAGTTTATCTCGAGATAAACTCGAAGTCTTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011863.1-936s1c1
Sequence:CCGGCATCAACTTATCGGTGCCTATCTCGAGATAGGCACCGATAAGTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-417s1c1
Sequence:CCGGCACCAGCTTTATATCGCCTTACTCGAGTAAGGCGATATAAAGCTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-1186s1c1
Sequence:CCGGGACCGGATTTACTGGAATGATCTCGAGATCATTCCAGTAAATCCGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011863.1-106s1c1
Sequence:CCGGGCAACCAACGTCACCTATCAACTCGAGTTGATAGGTGACGTTGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)