EMAIL THIS PAGE TO A FRIEND

PAQR4

progestin and adipoQ receptor family member IV

76 Gene Product Result for
UniProtKB ID: Q8N4S7, A8K5Q8, D3DUA2, D3DUA3, Q8NAS6, Q96NW1
Gene ID:
Mouse(76498) progestin and adipoQ receptor family member IV
Rat(302967) progestin and adipoQ receptor family member IV
dog(490051) progestin and adipoQ receptor family member IV
cow(507075) progestin and adipoQ receptor family member IV
domestic guinea pig(100734758) progestin and adipoQ receptor family member IV
naked mole-rat(101721096) progestin and adipoQ receptor family member IV
Goat(100861052) progestin and adipoQ receptor family member IV
sheep(101119527) progestin and adipoQ receptor family member IV
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152341 Rosetta Predictions human pricing
NM_001017377 Rosetta Predictions rat pricing
NM_023824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053110 predicted 456
2 SASI_Hs01_00053113 predicted 580
3 SASI_Hs01_00053114 predicted 836
4 SASI_Hs01_00053117 predicted 942
5 SASI_Hs01_00053108 predicted 1640
6 SASI_Hs01_00053109 predicted 1514
7 SASI_Hs01_00053111 predicted 1635
8 SASI_Hs01_00053112 predicted 1544
9 SASI_Hs01_00053115 predicted 1189
10 SASI_Hs02_00365959 predicted 1643
11 SASI_Hs01_00053116 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083411 predicted 767
2 SASI_Rn01_00083412 predicted 358
3 SASI_Rn01_00083413 predicted 565
4 SASI_Rn01_00083414 predicted 545
5 SASI_Rn01_00083415 predicted 650
6 SASI_Rn01_00083416 predicted 364
7 SASI_Rn02_00202216 predicted 334
8 SASI_Rn01_00083417 predicted 663
9 SASI_Rn01_00083418 predicted 661
10 SASI_Rn01_00083419 predicted 916
11 SASI_Rn01_00083420 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100818 predicted 748
2 SASI_Mm01_00100819 predicted 1022
3 SASI_Mm01_00100820 predicted 647
4 SASI_Mm01_00100822 predicted 359
5 SASI_Mm01_00100821 predicted 547
6 SASI_Mm01_00100823 predicted 938
7 SASI_Mm01_00100824 predicted 584
8 SASI_Mm01_00100825 predicted 650
9 SASI_Mm01_00100826 predicted 911
10 SASI_Mm01_00100827 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152341
PAQR4 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member IV
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-375s1c1
Sequence:CCGGCCGTGCTCTATCACCTCTTTACTCGAGTAAAGAGGTGATAGAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-145s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTGCTCTCGAGAGCACGAACTTATTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-220s1c1
Sequence:CCGGCCTGCACAACGAACTGGGCAACTCGAGTTGCCCAGTTCGTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-535s1c1
Sequence:CCGGCCTGGTGGGCTACACTGTGTTCTCGAGAACACAGTGTAGCCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152341.3-1045s21c1
Sequence:CCGGCAACTCCCACCAGATCATGCACTCGAGTGCATGATCTGGTGGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1467s21c1
Sequence:CCGGACGTCTTGCTCTGAGAGTTCACTCGAGTGAACTCTCAGAGCAAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1177s21c1
Sequence:CCGGACAGCAGCCTCCTAGAGTTAGCTCGAGCTAACTCTAGGAGGCTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152341
PAQR4 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member IV
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-375s1c1
Sequence:CCGGCCGTGCTCTATCACCTCTTTACTCGAGTAAAGAGGTGATAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-145s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTGCTCTCGAGAGCACGAACTTATTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-220s1c1
Sequence:CCGGCCTGCACAACGAACTGGGCAACTCGAGTTGCCCAGTTCGTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-535s1c1
Sequence:CCGGCCTGGTGGGCTACACTGTGTTCTCGAGAACACAGTGTAGCCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152341.3-1045s21c1
Sequence:CCGGCAACTCCCACCAGATCATGCACTCGAGTGCATGATCTGGTGGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1467s21c1
Sequence:CCGGACGTCTTGCTCTGAGAGTTCACTCGAGTGAACTCTCAGAGCAAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1177s21c1
Sequence:CCGGACAGCAGCCTCCTAGAGTTAGCTCGAGCTAACTCTAGGAGGCTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152341
PAQR4 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member IV
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-375s1c1
Sequence:CCGGCCGTGCTCTATCACCTCTTTACTCGAGTAAAGAGGTGATAGAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-145s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTGCTCTCGAGAGCACGAACTTATTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-220s1c1
Sequence:CCGGCCTGCACAACGAACTGGGCAACTCGAGTTGCCCAGTTCGTTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152341.2-535s1c1
Sequence:CCGGCCTGGTGGGCTACACTGTGTTCTCGAGAACACAGTGTAGCCCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152341.3-1045s21c1
Sequence:CCGGCAACTCCCACCAGATCATGCACTCGAGTGCATGATCTGGTGGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1467s21c1
Sequence:CCGGACGTCTTGCTCTGAGAGTTCACTCGAGTGAACTCTCAGAGCAAGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152341.3-1177s21c1
Sequence:CCGGACAGCAGCCTCCTAGAGTTAGCTCGAGCTAACTCTAGGAGGCTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023824
VALIDATED
PAQR4 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member IV
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023824.2-1931s1c1
Sequence:CCGGGCAACATCAATAAAGGGACAACTCGAGTTGTCCCTTTATTGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-655s1c1
Sequence:CCGGCCTTGGATATGTGTGGAGTCTCTCGAGAGACTCCACACATATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-356s1c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-360s1c1
Sequence:CCGGCTGCAGTTCAATAAGTTCGTACTCGAGTACGAACTTATTGAACTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023824.2-362s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTATTCTCGAGAATACGAACTTATTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-646s21c1
Sequence:CCGGGGCTCCTTGCCTTGGATATGTCTCGAGACATATCCAAGGCAAGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-440s21c1
Sequence:CCGGACACAACGAGCTGGGCAACATCTCGAGATGTTGCCCAGCTCGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023824.3-592s21c1
Sequence:CCGGCTGTGCTGTATCACCTCTTCACTCGAGTGAAGAGGTGATACAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-1157s21c1
Sequence:CCGGCCACAGCTTCCTGGACAAATTCTCGAGAATTTGTCCAGGAAGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-356s21c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023824
VALIDATED
PAQR4 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member IV
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023824.2-1931s1c1
Sequence:CCGGGCAACATCAATAAAGGGACAACTCGAGTTGTCCCTTTATTGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-655s1c1
Sequence:CCGGCCTTGGATATGTGTGGAGTCTCTCGAGAGACTCCACACATATCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-356s1c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-360s1c1
Sequence:CCGGCTGCAGTTCAATAAGTTCGTACTCGAGTACGAACTTATTGAACTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023824.2-362s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTATTCTCGAGAATACGAACTTATTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-646s21c1
Sequence:CCGGGGCTCCTTGCCTTGGATATGTCTCGAGACATATCCAAGGCAAGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-440s21c1
Sequence:CCGGACACAACGAGCTGGGCAACATCTCGAGATGTTGCCCAGCTCGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023824.3-592s21c1
Sequence:CCGGCTGTGCTGTATCACCTCTTCACTCGAGTGAAGAGGTGATACAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-1157s21c1
Sequence:CCGGCCACAGCTTCCTGGACAAATTCTCGAGAATTTGTCCAGGAAGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-356s21c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023824
VALIDATED
PAQR4 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member IV
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023824.2-1931s1c1
Sequence:CCGGGCAACATCAATAAAGGGACAACTCGAGTTGTCCCTTTATTGATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-655s1c1
Sequence:CCGGCCTTGGATATGTGTGGAGTCTCTCGAGAGACTCCACACATATCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-356s1c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023824.2-360s1c1
Sequence:CCGGCTGCAGTTCAATAAGTTCGTACTCGAGTACGAACTTATTGAACTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023824.2-362s1c1
Sequence:CCGGGCAGTTCAATAAGTTCGTATTCTCGAGAATACGAACTTATTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-646s21c1
Sequence:CCGGGGCTCCTTGCCTTGGATATGTCTCGAGACATATCCAAGGCAAGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-440s21c1
Sequence:CCGGACACAACGAGCTGGGCAACATCTCGAGATGTTGCCCAGCTCGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023824.3-592s21c1
Sequence:CCGGCTGTGCTGTATCACCTCTTCACTCGAGTGAAGAGGTGATACAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-1157s21c1
Sequence:CCGGCCACAGCTTCCTGGACAAATTCTCGAGAATTTGTCCAGGAAGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023824.3-356s21c1
Sequence:CCGGGCACCTGCAGTTCAATAAGTTCTCGAGAACTTATTGAACTGCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)