EMAIL THIS PAGE TO A FRIEND

PAQR5

progestin and adipoQ receptor family member V

117 Gene Product Result for
Synonyms: MPRG
UniProtKB ID: Q9NXK6, Q8IXU2
Gene ID:
Mouse(74090) progestin and adipoQ receptor family member V
Rat(315741) progestin and adipoQ receptor family member V
sheep(101113764) progestin and adipoQ receptor family member V
naked mole-rat(101702683) progestin and adipoQ receptor family member V
domestic guinea pig(100732240) progestin and adipoQ receptor family member V
chicken(427516) progestin and adipoQ receptor family member V
dog(487623) progestin and adipoQ receptor family member V
cow(527461) progestin and adipoQ receptor family member V
domestic cat(101098465) progestin and adipoQ receptor family member V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104554 Rosetta Predictions human pricing
NM_017705 Rosetta Predictions human pricing
NM_001014092 Rosetta Predictions rat pricing
NM_028748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323724 predicted 869
2 SASI_Hs02_00323725 predicted 1754
3 SASI_Hs02_00323726 predicted 1554
4 SASI_Hs02_00323727 predicted 1733
5 SASI_Hs02_00323728 predicted 800
6 SASI_Hs02_00323729 predicted 796
7 SASI_Hs02_00323730 predicted 1471
8 SASI_Hs02_00323731 predicted 1703
9 SASI_Hs02_00323732 predicted 1396
10 SASI_Hs02_00323733 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092817 predicted 582
2 SASI_Hs01_00092818 predicted 1463
3 SASI_Hs01_00092820 predicted 1267
4 SASI_Hs02_00350463 predicted 1441
5 SASI_Hs01_00092821 predicted 513
6 SASI_Hs01_00092822 predicted 506
7 SASI_Hs02_00350464 predicted 1184
8 SASI_Hs01_00092823 predicted 1408
9 SASI_Hs01_00092824 predicted 1110
10 SASI_Hs01_00092825 predicted 520
11 SASI_Hs01_00092819 predicted 1452
12 SASI_Hs01_00092826 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106681 predicted 685
2 SASI_Rn01_00106682 predicted 516
3 SASI_Rn01_00106683 predicted 678
4 SASI_Rn01_00106685 predicted 454
5 SASI_Rn01_00106686 predicted 1099
6 SASI_Rn01_00106687 predicted 520
7 SASI_Rn02_00201524 predicted 514
8 SASI_Rn01_00106689 predicted 1075
9 SASI_Rn02_00201525 predicted 1181
10 SASI_Rn02_00201526 predicted 820
11 SASI_Rn01_00106684 predicted 838
12 SASI_Rn01_00106688 predicted 500
13 SASI_Rn01_00106690 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087500 predicted 557
2 SASI_Mm01_00087501 predicted 433
3 SASI_Mm01_00087502 predicted 395
4 SASI_Mm01_00087503 predicted 546
5 SASI_Mm01_00087504 predicted 834
6 SASI_Mm01_00087506 predicted 660
7 SASI_Mm02_00334328 predicted 347
8 SASI_Mm01_00087507 predicted 331
9 SASI_Mm02_00334329 predicted 1067
10 SASI_Mm01_00087508 predicted 265
11 SASI_Mm01_00087505 predicted 714
12 SASI_Mm01_00087509 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017705
VALIDATED
PAQR5 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member V
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-515s21c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1333s21c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1242s21c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-687s21c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-2088s1c1
Sequence:CCGGGCCAGTTTGATCTGCAAAGTACTCGAGTACTTTGCAGATCAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1333s1c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-687s1c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-515s1c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1242s1c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017705
VALIDATED
PAQR5 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member V
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-515s21c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1333s21c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1242s21c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-687s21c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-2088s1c1
Sequence:CCGGGCCAGTTTGATCTGCAAAGTACTCGAGTACTTTGCAGATCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1333s1c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-687s1c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-515s1c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1242s1c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017705
VALIDATED
PAQR5 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member V
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-515s21c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1333s21c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-1242s21c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017705.3-687s21c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-2088s1c1
Sequence:CCGGGCCAGTTTGATCTGCAAAGTACTCGAGTACTTTGCAGATCAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1333s1c1
Sequence:CCGGCGGATTCCCAAGCCAGAATTACTCGAGTAATTCTGGCTTGGGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-687s1c1
Sequence:CCGGCTTCAGCTCTATGTCCAAGAACTCGAGTTCTTGGACATAGAGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-515s1c1
Sequence:CCGGCCAATGAGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017705.2-1242s1c1
Sequence:CCGGGCCCTTCTCTTTCTCTCAGATCTCGAGATCTGAGAGAAAGAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028748
PAQR5 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member V
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028748.1-3076s1c1
Sequence:CCGGGCAAGCATCAAGGTGAGTTTACTCGAGTAAACTCACCTTGATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028748.1-830s1c1
Sequence:CCGGGAGTTCAAGAAATGAAGCCATCTCGAGATGGCTTCATTTCTTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-1115s1c1
Sequence:CCGGCAGCCTCAGCAACATTATTTACTCGAGTAAATAATGTTGCTGAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-392s1c1
Sequence:CCGGGAGGTTCATGACTGCACTCTACTCGAGTAGAGTGCAGTCATGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-506s1c1
Sequence:CCGGCACATTCAGCTCTATGTCCAACTCGAGTTGGACATAGAGCTGAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028748
PAQR5 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member V
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028748.1-3076s1c1
Sequence:CCGGGCAAGCATCAAGGTGAGTTTACTCGAGTAAACTCACCTTGATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028748.1-830s1c1
Sequence:CCGGGAGTTCAAGAAATGAAGCCATCTCGAGATGGCTTCATTTCTTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-1115s1c1
Sequence:CCGGCAGCCTCAGCAACATTATTTACTCGAGTAAATAATGTTGCTGAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-392s1c1
Sequence:CCGGGAGGTTCATGACTGCACTCTACTCGAGTAGAGTGCAGTCATGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-506s1c1
Sequence:CCGGCACATTCAGCTCTATGTCCAACTCGAGTTGGACATAGAGCTGAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028748
PAQR5 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member V
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028748.1-3076s1c1
Sequence:CCGGGCAAGCATCAAGGTGAGTTTACTCGAGTAAACTCACCTTGATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028748.1-830s1c1
Sequence:CCGGGAGTTCAAGAAATGAAGCCATCTCGAGATGGCTTCATTTCTTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-1115s1c1
Sequence:CCGGCAGCCTCAGCAACATTATTTACTCGAGTAAATAATGTTGCTGAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-392s1c1
Sequence:CCGGGAGGTTCATGACTGCACTCTACTCGAGTAGAGTGCAGTCATGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028748.1-506s1c1
Sequence:CCGGCACATTCAGCTCTATGTCCAACTCGAGTTGGACATAGAGCTGAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)