EMAIL THIS PAGE TO A FRIEND

PAQR8

progestin and adipoQ receptor family member VIII

198 Gene Product Result for
Synonyms: C6orf33 LMPB1 MPRB
UniProtKB ID: Q8TEZ7, B2RCF6, Q86WL0, Q8N6D3, Q9HD02
Gene ID:
Mouse(74229) progestin and adipoQ receptor family member VIII
Rat(316275) progestin and adipoQ receptor family member VIII
Zebrafish(368254) progestin and adipoQ receptor family member VIII
cow(531018) progestin and adipoQ receptor family member VIII
Horse(100056251) progestin and adipoQ receptor family member VIII
domestic cat(101083770) progestin and adipoQ receptor family member VIII
dog(481840) progestin and adipoQ receptor family member VIII
chicken(422042) progestin and adipoQ receptor family member VIII
domestic guinea pig(100729833) progestin and adipoQ receptor family member VIII
naked mole-rat(101718210) progestin and adipoQ receptor family member VIII
sheep(101104939) progestin and adipoQ receptor family member VIII
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA064625 Anti-PAQR8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059631 MISSION® esiRNA esiRNA human PAQR8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133367 Rosetta Predictions human pricing
NM_001014099 Rosetta Predictions rat pricing
NM_028829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100042 predicted 779
2 SASI_Hs01_00100044 predicted 595
3 SASI_Hs01_00100045 predicted 358
4 SASI_Hs01_00100046 predicted 1473
5 SASI_Hs02_00363058 predicted 505
6 SASI_Hs01_00100047 predicted 1008
7 SASI_Hs02_00363059 predicted 1464
8 SASI_Hs01_00100049 predicted 1502
9 SASI_Hs01_00100050 predicted 676
10 SASI_Hs01_00100051 predicted 313
11 SASI_Hs01_00100043 predicted 1469
12 SASI_Hs01_00100048 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095720 predicted 638
2 SASI_Rn02_00201536 predicted 1057
3 SASI_Rn01_00095721 predicted 1076
4 SASI_Rn01_00095722 predicted 1339
5 SASI_Rn01_00095723 predicted 783
6 SASI_Rn01_00095724 predicted 1045
7 SASI_Rn01_00095725 predicted 673
8 SASI_Rn01_00095726 predicted 508
9 SASI_Rn01_00095727 predicted 624
10 SASI_Rn01_00095728 predicted 960
11 SASI_Rn01_00095729 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104852 predicted 465
2 SASI_Mm01_00104853 predicted 904
3 SASI_Mm01_00104854 predicted 700
4 SASI_Mm01_00104855 predicted 304
5 SASI_Mm01_00104856 predicted 886
6 SASI_Mm01_00104857 predicted 698
7 SASI_Mm01_00104858 predicted 1777
8 SASI_Mm01_00104860 predicted 526
9 SASI_Mm02_00334462 predicted 1833
10 SASI_Mm02_00334463 predicted 1050
11 SASI_Mm01_00104851 predicted 711
12 SASI_Mm01_00104859 predicted 1686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133367
VALIDATED
PAQR8 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member VIII
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-503s1c1
Sequence:CCGGCCTCTTCATCCTGTCGTCAATCTCGAGATTGACGACAGGATGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133367.1-926s1c1
Sequence:CCGGCTTCCTGGTTAGCGCTTATTTCTCGAGAAATAAGCGCTAACCAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_133367.1-393s1c1
Sequence:CCGGGTCAACGTCTGGACCCATTTACTCGAGTAAATGGGTCCAGACGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1203s1c1
Sequence:CCGGGCCAGACTGACCAAGAAAGATCTCGAGATCTTTCTTGGTCAGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1176s1c1
Sequence:CCGGGCAGCCCTTCTGAGGCACAAACTCGAGTTTGTGCCTCAGAAGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-514s21c1
Sequence:CCGGCTCTTCATCCTGTCGTCAATCCTCGAGGATTGACGACAGGATGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-1676s21c1
Sequence:CCGGTTGACCCAAGGACCGAATTTCCTCGAGGAAATTCGGTCCTTGGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-3157s21c1
Sequence:CCGGTGTTAGTAGAAGGTCAATTTACTCGAGTAAATTGACCTTCTACTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-937s21c1
Sequence:CCGGTTCCTGGTTAGCGCTTATTTCCTCGAGGAAATAAGCGCTAACCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-769s21c1
Sequence:CCGGTATCGTTACCGGAGGCCTTATCTCGAGATAAGGCCTCCGGTAACGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-623s21c1
Sequence:CCGGGCGTGAGCGTTTACCAATATGCTCGAGCATATTGGTAAACGCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-723s21c1
Sequence:CCGGTGCCTTCTGTGGCTGGTTATCCTCGAGGATAACCAGCCACAGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-1211s21c1
Sequence:CCGGAGGCCAGACTGACCAAGAAAGCTCGAGCTTTCTTGGTCAGTCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133367
VALIDATED
PAQR8 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member VIII
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-503s1c1
Sequence:CCGGCCTCTTCATCCTGTCGTCAATCTCGAGATTGACGACAGGATGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133367.1-926s1c1
Sequence:CCGGCTTCCTGGTTAGCGCTTATTTCTCGAGAAATAAGCGCTAACCAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_133367.1-393s1c1
Sequence:CCGGGTCAACGTCTGGACCCATTTACTCGAGTAAATGGGTCCAGACGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1203s1c1
Sequence:CCGGGCCAGACTGACCAAGAAAGATCTCGAGATCTTTCTTGGTCAGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1176s1c1
Sequence:CCGGGCAGCCCTTCTGAGGCACAAACTCGAGTTTGTGCCTCAGAAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-514s21c1
Sequence:CCGGCTCTTCATCCTGTCGTCAATCCTCGAGGATTGACGACAGGATGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-1676s21c1
Sequence:CCGGTTGACCCAAGGACCGAATTTCCTCGAGGAAATTCGGTCCTTGGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-3157s21c1
Sequence:CCGGTGTTAGTAGAAGGTCAATTTACTCGAGTAAATTGACCTTCTACTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-937s21c1
Sequence:CCGGTTCCTGGTTAGCGCTTATTTCCTCGAGGAAATAAGCGCTAACCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-769s21c1
Sequence:CCGGTATCGTTACCGGAGGCCTTATCTCGAGATAAGGCCTCCGGTAACGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-623s21c1
Sequence:CCGGGCGTGAGCGTTTACCAATATGCTCGAGCATATTGGTAAACGCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-723s21c1
Sequence:CCGGTGCCTTCTGTGGCTGGTTATCCTCGAGGATAACCAGCCACAGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-1211s21c1
Sequence:CCGGAGGCCAGACTGACCAAGAAAGCTCGAGCTTTCTTGGTCAGTCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133367
VALIDATED
PAQR8 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member VIII
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-503s1c1
Sequence:CCGGCCTCTTCATCCTGTCGTCAATCTCGAGATTGACGACAGGATGAAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133367.1-926s1c1
Sequence:CCGGCTTCCTGGTTAGCGCTTATTTCTCGAGAAATAAGCGCTAACCAGGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_133367.1-393s1c1
Sequence:CCGGGTCAACGTCTGGACCCATTTACTCGAGTAAATGGGTCCAGACGTTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1203s1c1
Sequence:CCGGGCCAGACTGACCAAGAAAGATCTCGAGATCTTTCTTGGTCAGTCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133367.1-1176s1c1
Sequence:CCGGGCAGCCCTTCTGAGGCACAAACTCGAGTTTGTGCCTCAGAAGGGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-514s21c1
Sequence:CCGGCTCTTCATCCTGTCGTCAATCCTCGAGGATTGACGACAGGATGAAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-1676s21c1
Sequence:CCGGTTGACCCAAGGACCGAATTTCCTCGAGGAAATTCGGTCCTTGGGTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133367.4-3157s21c1
Sequence:CCGGTGTTAGTAGAAGGTCAATTTACTCGAGTAAATTGACCTTCTACTAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-937s21c1
Sequence:CCGGTTCCTGGTTAGCGCTTATTTCCTCGAGGAAATAAGCGCTAACCAGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-769s21c1
Sequence:CCGGTATCGTTACCGGAGGCCTTATCTCGAGATAAGGCCTCCGGTAACGATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-623s21c1
Sequence:CCGGGCGTGAGCGTTTACCAATATGCTCGAGCATATTGGTAAACGCTCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-723s21c1
Sequence:CCGGTGCCTTCTGTGGCTGGTTATCCTCGAGGATAACCAGCCACAGAAGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_133367.4-1211s21c1
Sequence:CCGGAGGCCAGACTGACCAAGAAAGCTCGAGCTTTCTTGGTCAGTCTGGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028829
PAQR8 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member VIII
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-701s1c1
Sequence:CCGGGTCCCACTACACGTTCTACTTCTCGAGAAGTAGAACGTGTAGTGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-467s1c1
Sequence:CCGGCGAGTGGCGTTACTACTTCTTCTCGAGAAGAAGTAGTAACGCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028829.3-1496s21c1
Sequence:CCGGCATTGGTAGAGAGTGCTTATACTCGAGTATAAGCACTCTCTACCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028829.3-1914s1c1
Sequence:CCGGGCCAAGTATAACCTTGCCCTACTCGAGTAGGGCAAGGTTATACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-863s1c1
Sequence:CCGGTGGCTGTTGTTATGCCAAGTACTCGAGTACTTGGCATAACAACAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1320s21c1
Sequence:CCGGGTCAAGGACAGACTGATTAAGCTCGAGCTTAATCAGTCTGTCCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1344s21c1
Sequence:CCGGGATTCCTGAGGTCCTTCAAATCTCGAGATTTGAAGGACCTCAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028829
PAQR8 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member VIII
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-701s1c1
Sequence:CCGGGTCCCACTACACGTTCTACTTCTCGAGAAGTAGAACGTGTAGTGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-467s1c1
Sequence:CCGGCGAGTGGCGTTACTACTTCTTCTCGAGAAGAAGTAGTAACGCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028829.3-1496s21c1
Sequence:CCGGCATTGGTAGAGAGTGCTTATACTCGAGTATAAGCACTCTCTACCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028829.3-1914s1c1
Sequence:CCGGGCCAAGTATAACCTTGCCCTACTCGAGTAGGGCAAGGTTATACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-863s1c1
Sequence:CCGGTGGCTGTTGTTATGCCAAGTACTCGAGTACTTGGCATAACAACAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1320s21c1
Sequence:CCGGGTCAAGGACAGACTGATTAAGCTCGAGCTTAATCAGTCTGTCCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1344s21c1
Sequence:CCGGGATTCCTGAGGTCCTTCAAATCTCGAGATTTGAAGGACCTCAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028829
PAQR8 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member VIII
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-701s1c1
Sequence:CCGGGTCCCACTACACGTTCTACTTCTCGAGAAGTAGAACGTGTAGTGGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-467s1c1
Sequence:CCGGCGAGTGGCGTTACTACTTCTTCTCGAGAAGAAGTAGTAACGCCACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028829.3-1496s21c1
Sequence:CCGGCATTGGTAGAGAGTGCTTATACTCGAGTATAAGCACTCTCTACCAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028829.3-1914s1c1
Sequence:CCGGGCCAAGTATAACCTTGCCCTACTCGAGTAGGGCAAGGTTATACTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028829.3-863s1c1
Sequence:CCGGTGGCTGTTGTTATGCCAAGTACTCGAGTACTTGGCATAACAACAGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1320s21c1
Sequence:CCGGGTCAAGGACAGACTGATTAAGCTCGAGCTTAATCAGTCTGTCCTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028829.3-1344s21c1
Sequence:CCGGGATTCCTGAGGTCCTTCAAATCTCGAGATTTGAAGGACCTCAGGAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???