EMAIL THIS PAGE TO A FRIEND

PARD3

par-3 family cell polarity regulator

96 Gene Product Result for
Synonyms: ASIP Baz PAR3 PAR3alpha PARD-3 PARD3A SE2-5L16 SE2-5LT1 SE2-5T2
Gene ID:
Human(56288) Summary: This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(93742) par-3 (partitioning defective 3) homolog (C. elegans)
Rat(81918) par-3 (partitioning defective 3) homolog (C. elegans)
Zebrafish(403050) par-3 partitioning defective 3 homolog (C. elegans)
chicken(420468) par-3 partitioning defective 3 homolog (C. elegans)
dog(477953) par-3 partitioning defective 3 homolog (C. elegans)
domestic cat(101100223) par-3 partitioning defective 3 homolog (C. elegans)
cow(527964) par-3 partitioning defective 3 homolog (C. elegans)
Horse(100060218) par-3 partitioning defective 3 homolog (C. elegans)
sheep(101110782) par-3 partitioning defective 3 homolog (C. elegans)
domestic guinea pig(100721421) par-3 partitioning defective 3 homolog (C. elegans)
naked mole-rat(101705735) par-3 partitioning defective 3 homolog (C. elegans)
Domestic Rabbit(100345030) par-3 partitioning defective 3 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019619 Rosetta Predictions human pricing
NM_031235 Rosetta Predictions rat pricing
NM_001013580 Rosetta Predictions mouse pricing
NM_001013581 Rosetta Predictions mouse pricing
NM_001122850 Rosetta Predictions mouse pricing
NM_033620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189008 predicted 2510
2 SASI_Hs02_00352837 predicted 1315
3 SASI_Hs01_00189011 predicted 1892
4 SASI_Hs01_00189012 predicted 1240
5 SASI_Hs01_00189013 predicted 1930
6 SASI_Hs02_00352838 predicted 2011
7 SASI_Hs01_00189014 predicted 3354
8 SASI_Hs01_00189015 predicted 1325
9 SASI_Hs01_00189016 predicted 2207
10 SASI_Hs01_00189017 predicted 1115
11 SASI_Hs01_00189009 predicted 1985
12 SASI_Hs01_00189010 predicted 2126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048688 predicted 2771
2 SASI_Rn01_00048690 predicted 3506
3 SASI_Rn01_00048691 predicted 3039
4 SASI_Rn01_00048692 predicted 3775
5 SASI_Rn02_00264509 predicted 1796
6 SASI_Rn01_00048693 predicted 2172
7 SASI_Rn02_00264510 predicted 2019
8 SASI_Rn01_00048694 predicted 607
9 SASI_Rn01_00048695 predicted 688
10 SASI_Rn01_00048696 predicted 2469
11 SASI_Rn01_00048689 predicted 587
12 SASI_Rn01_00048697 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109226 predicted 763
2 SASI_Mm01_00109227 predicted 1594
3 SASI_Mm01_00109228 predicted 1133
4 SASI_Mm01_00109229 predicted 744
5 SASI_Mm01_00109230 predicted 1650
6 SASI_Mm01_00109231 predicted 1287
7 SASI_Mm01_00109233 predicted 1207
8 SASI_Mm02_00287243 predicted 1409
9 SASI_Mm01_00109234 predicted 829
10 SASI_Mm01_00109235 predicted 1128
11 SASI_Mm01_00109232 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287244 predicted 2298
2 SASI_Mm01_00073406 predicted 807
3 SASI_Mm02_00287245 predicted 2900
4 SASI_Mm01_00073408 predicted 1176
5 SASI_Mm02_00287246 predicted 2915
6 SASI_Mm01_00073409 predicted 783
7 SASI_Mm02_00287247 predicted 2686
8 SASI_Mm02_00287248 predicted 2241
9 SASI_Mm02_00287249 predicted 2194
10 SASI_Mm01_00073411 predicted 1321
11 SASI_Mm01_00073407 predicted 1638
12 SASI_Mm01_00073410 predicted 1703
13 SASI_Mm01_00073412 predicted 1364
14 SASI_Mm01_00073413 predicted 1251
15 SASI_Mm01_00073414 predicted 875
16 SASI_Mm01_00073415 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309499 predicted 1313
2 SASI_Mm02_00309500 predicted 2144
3 SASI_Mm02_00309501 predicted 1686
4 SASI_Mm02_00309502 predicted 1292
5 SASI_Mm02_00309503 predicted 2207
6 SASI_Mm02_00309504 predicted 1834
7 SASI_Mm02_00309505 predicted 1753
8 SASI_Mm02_00309506 predicted 1954
9 SASI_Mm02_00309507 predicted 1375
10 SASI_Mm02_00309508 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032553 predicted 1316
2 SASI_Mm01_00032554 predicted 2151
3 SASI_Mm01_00032555 predicted 1684
4 SASI_Mm01_00032556 predicted 1297
5 SASI_Mm01_00032557 predicted 2208
6 SASI_Mm01_00032558 predicted 1836
7 SASI_Mm01_00032560 predicted 1752
8 SASI_Mm02_00337478 predicted 1957
9 SASI_Mm01_00032561 predicted 1374
10 SASI_Mm01_00032562 predicted 1668
11 SASI_Mm01_00032559 predicted 1687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019619
VALIDATED
PARD3 MISSION shRNA Bacterial Glycerol Stock
par-3 family cell polarity regulator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-1839s1c1
Sequence:CCGGCCACGCAGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCTGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2782s1c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2783s1c1
Sequence:CCGGCCATCGACAAATCTTATGATACTCGAGTATCATAAGATTTGTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-2017s1c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-3919s1c1
Sequence:CCGGCCCAGCAACTATGACTCGTATCTCGAGATACGAGTCATAGTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-770s21c1
Sequence:CCGGACACGGGTTTGGAGCATATACCTCGAGGTATATGCTCCAAACCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019619.2-2017s21c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2518s21c1
Sequence:CCGGAGTCAATTGGATTTCGTTAAACTCGAGTTTAACGAAATCCAATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2782s21c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019619
VALIDATED
PARD3 MISSION shRNA shRNA Plasmid DNA
par-3 family cell polarity regulator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-1839s1c1
Sequence:CCGGCCACGCAGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCTGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2782s1c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2783s1c1
Sequence:CCGGCCATCGACAAATCTTATGATACTCGAGTATCATAAGATTTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-2017s1c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-3919s1c1
Sequence:CCGGCCCAGCAACTATGACTCGTATCTCGAGATACGAGTCATAGTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-770s21c1
Sequence:CCGGACACGGGTTTGGAGCATATACCTCGAGGTATATGCTCCAAACCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019619.2-2017s21c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2518s21c1
Sequence:CCGGAGTCAATTGGATTTCGTTAAACTCGAGTTTAACGAAATCCAATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2782s21c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019619
VALIDATED
PARD3 MISSION shRNA Lentiviral Transduction Particles
par-3 family cell polarity regulator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-1839s1c1
Sequence:CCGGCCACGCAGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCTGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2782s1c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-2783s1c1
Sequence:CCGGCCATCGACAAATCTTATGATACTCGAGTATCATAAGATTTGTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019619.2-2017s1c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019619.2-3919s1c1
Sequence:CCGGCCCAGCAACTATGACTCGTATCTCGAGATACGAGTCATAGTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-770s21c1
Sequence:CCGGACACGGGTTTGGAGCATATACCTCGAGGTATATGCTCCAAACCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019619.2-2017s21c1
Sequence:CCGGCGAGGAATGATCCAGCTTATTCTCGAGAATAAGCTGGATCATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2518s21c1
Sequence:CCGGAGTCAATTGGATTTCGTTAAACTCGAGTTTAACGAAATCCAATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_019619.2-2782s21c1
Sequence:CCGGGCCATCGACAAATCTTATGATCTCGAGATCATAAGATTTGTCGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013580
VALIDATED
PARD3 MISSION shRNA Bacterial Glycerol Stock
par-3 family cell polarity regulator
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013580.1-3447s1c1
Sequence:CCGGCCAGTTTATCTCTATCACTTTCTCGAGAAAGTGATAGAGATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1249s1c1
Sequence:CCGGGCTCCCATTTATGTCAAGAATCTCGAGATTCTTGACATAAATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1340s1c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-811s1c1
Sequence:CCGGGCACAACATATGTTCCGCCAACTCGAGTTGGCGGAACATATGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013580.1-1998s1c1
Sequence:CCGGGAGCAGGATAATGGGAACATACTCGAGTATGTTCCCATTATCCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013580.3-2136s21c1
Sequence:CCGGGGGTTGAGGAGTACGTCATTTCTCGAGAAATGACGTACTCCTCAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1296s21c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1604s21c1
Sequence:CCGGATCTTCGTTAAATCCATTATCCTCGAGGATAATGGATTTAACGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1579s21c1
Sequence:CCGGCAAAGAGAACCACGCAGATTTCTCGAGAAATCTGCGTGGTTCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-757s21c1
Sequence:CCGGATTTGAGCAAGCACAACATATCTCGAGATATGTTGTGCTTGCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013580
VALIDATED
PARD3 MISSION shRNA shRNA Plasmid DNA
par-3 family cell polarity regulator
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013580.1-3447s1c1
Sequence:CCGGCCAGTTTATCTCTATCACTTTCTCGAGAAAGTGATAGAGATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1249s1c1
Sequence:CCGGGCTCCCATTTATGTCAAGAATCTCGAGATTCTTGACATAAATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1340s1c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-811s1c1
Sequence:CCGGGCACAACATATGTTCCGCCAACTCGAGTTGGCGGAACATATGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013580.1-1998s1c1
Sequence:CCGGGAGCAGGATAATGGGAACATACTCGAGTATGTTCCCATTATCCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013580.3-2136s21c1
Sequence:CCGGGGGTTGAGGAGTACGTCATTTCTCGAGAAATGACGTACTCCTCAACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1296s21c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1604s21c1
Sequence:CCGGATCTTCGTTAAATCCATTATCCTCGAGGATAATGGATTTAACGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1579s21c1
Sequence:CCGGCAAAGAGAACCACGCAGATTTCTCGAGAAATCTGCGTGGTTCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-757s21c1
Sequence:CCGGATTTGAGCAAGCACAACATATCTCGAGATATGTTGTGCTTGCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013580
VALIDATED
PARD3 MISSION shRNA Lentiviral Transduction Particles
par-3 family cell polarity regulator
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013580.1-3447s1c1
Sequence:CCGGCCAGTTTATCTCTATCACTTTCTCGAGAAAGTGATAGAGATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1249s1c1
Sequence:CCGGGCTCCCATTTATGTCAAGAATCTCGAGATTCTTGACATAAATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-1340s1c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013580.1-811s1c1
Sequence:CCGGGCACAACATATGTTCCGCCAACTCGAGTTGGCGGAACATATGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013580.1-1998s1c1
Sequence:CCGGGAGCAGGATAATGGGAACATACTCGAGTATGTTCCCATTATCCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013580.3-2136s21c1
Sequence:CCGGGGGTTGAGGAGTACGTCATTTCTCGAGAAATGACGTACTCCTCAACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1296s21c1
Sequence:CCGGGAGTAGATTTAGCAGGCAAATCTCGAGATTTGCCTGCTAAATCTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1604s21c1
Sequence:CCGGATCTTCGTTAAATCCATTATCCTCGAGGATAATGGATTTAACGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-1579s21c1
Sequence:CCGGCAAAGAGAACCACGCAGATTTCTCGAGAAATCTGCGTGGTTCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013580.3-757s21c1
Sequence:CCGGATTTGAGCAAGCACAACATATCTCGAGATATGTTGTGCTTGCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)