EMAIL THIS PAGE TO A FRIEND

PARD6A

par-6 family cell polarity regulator alpha

113 Gene Product Result for
Synonyms: PAR-6A PAR6 PAR6C PAR6alpha TAX40 TIP-40
UniProtKB ID: Q9NPB6, O14911, Q9NPJ7
Gene ID:
Human(50855) Summary: This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(56513) par-6 (partitioning defective 6,) homolog alpha (C. elegans)
Rat(307799) par-6 (partitioning defective 6,) homolog alpha (C. elegans)
sheep(101114893) par-6 partitioning defective 6 homolog alpha (C. elegans)
domestic guinea pig(100732023) par-6 partitioning defective 6 homolog alpha (C. elegans)
naked mole-rat(101707435) par-6 partitioning defective 6 homolog alpha (C. elegans)
Zebrafish(792828) par-6 partitioning defective 6 homolog alpha (C. elegans)
chicken(101748842) par-6 partitioning defective 6 homolog alpha (C. elegans)
cow(524653) par-6 partitioning defective 6 homolog alpha (C. elegans)
Horse(100053411) par-6 partitioning defective 6 homolog alpha (C. elegans)
domestic cat(101101605) par-6 partitioning defective 6 homolog alpha (C. elegans)
dog(489756) par-6 partitioning defective 6 homolog alpha (C. elegans)
chicken(427529) par-6 partitioning defective 6 homolog alpha (C. elegans)
chicken(101666162) par-6 partitioning defective 6 homolog alpha (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037281 Rosetta Predictions human pricing
NM_016948 Rosetta Predictions human pricing
NM_001003653 Rosetta Predictions rat pricing
NM_001003654 Rosetta Predictions rat pricing
XM_579099 Rosetta Predictions rat pricing
NM_001047435 Rosetta Predictions mouse pricing
NM_001047436 Rosetta Predictions mouse pricing
NM_019695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308251 predicted 773
2 SASI_Hs01_00169184 predicted 757
3 SASI_Hs01_00169185 predicted 800
4 SASI_Hs01_00169186 predicted 924
5 SASI_Hs01_00169187 predicted 760
6 SASI_Hs01_00169188 predicted 782
7 SASI_Hs01_00169189 predicted 968
8 SASI_Hs01_00169190 predicted 908
9 SASI_Hs01_00169191 predicted 961
10 SASI_Hs01_00169192 predicted 740
11 SASI_Hs01_00169183 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349952 predicted 769
2 SASI_Hs01_00127276 predicted 760
3 SASI_Hs01_00127277 predicted 797
4 SASI_Hs01_00127278 predicted 935
5 SASI_Hs01_00127279 predicted 759
6 SASI_Hs01_00127280 predicted 781
7 SASI_Hs01_00127281 predicted 965
8 SASI_Hs01_00127282 predicted 907
9 SASI_Hs01_00127283 predicted 968
10 SASI_Hs01_00127284 predicted 748
11 SASI_Hs01_00127275 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198043 predicted 494
2 SASI_Rn01_00058825 predicted 665
3 SASI_Rn02_00198044 predicted 869
4 SASI_Rn01_00058826 predicted 472
5 SASI_Rn01_00058827 predicted 770
6 SASI_Rn01_00058828 predicted 682
7 SASI_Rn01_00058829 predicted 720
8 SASI_Rn01_00058831 predicted 484
9 SASI_Rn02_00198045 predicted 906
10 SASI_Rn01_00058833 predicted 413
11 SASI_Rn01_00058824 predicted 693
12 SASI_Rn01_00058830 predicted 820
13 SASI_Rn01_00058832 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037678 predicted 804
2 SASI_Rn01_00037680 predicted 690
3 SASI_Rn02_00198046 predicted 902
4 SASI_Rn01_00037681 predicted 797
5 SASI_Rn01_00037682 predicted 713
6 SASI_Rn01_00037683 predicted 754
7 SASI_Rn02_00198047 predicted 855
8 SASI_Rn02_00198048 predicted 934
9 SASI_Rn01_00037687 predicted 989
10 SASI_Rn02_00198049 predicted 589
11 SASI_Rn01_00037679 predicted 727
12 SASI_Rn01_00037684 predicted 844
13 SASI_Rn01_00037685 predicted 850
14 SASI_Rn01_00037686 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190207 predicted 716
2 SASI_Rn01_00190208 predicted 649
3 SASI_Rn01_00190209 predicted 690
4 SASI_Rn01_00190210 predicted 665
5 SASI_Rn01_00190211 predicted 656
6 SASI_Rn01_00190212 predicted 695
7 SASI_Rn01_00190213 predicted 728
8 SASI_Rn01_00190214 predicted 539
9 SASI_Rn01_00190215 predicted 708
10 SASI_Rn01_00190216 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291911 predicted 782
2 SASI_Mm02_00291912 predicted 825
3 SASI_Mm02_00291913 predicted 739
4 SASI_Mm02_00291914 predicted 780
5 SASI_Mm02_00291915 predicted 924
6 SASI_Mm02_00291916 predicted 715
7 SASI_Mm02_00291917 predicted 743
8 SASI_Mm02_00291918 predicted 761
9 SASI_Mm02_00291919 predicted 899
10 SASI_Mm02_00291920 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291921 predicted 789
2 SASI_Mm02_00291922 predicted 834
3 SASI_Mm02_00291923 predicted 756
4 SASI_Mm02_00291924 predicted 793
5 SASI_Mm02_00291925 predicted 944
6 SASI_Mm02_00291926 predicted 729
7 SASI_Mm02_00291927 predicted 758
8 SASI_Mm02_00291928 predicted 767
9 SASI_Mm02_00291929 predicted 911
10 SASI_Mm02_00291930 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151492 predicted 782
2 SASI_Mm01_00151493 predicted 829
3 SASI_Mm01_00151494 predicted 744
4 SASI_Mm01_00151495 predicted 785
5 SASI_Mm02_00324792 predicted 932
6 SASI_Mm02_00324793 predicted 718
7 SASI_Mm01_00151496 predicted 748
8 SASI_Mm02_00324794 predicted 763
9 SASI_Mm01_00151497 predicted 900
10 SASI_Mm02_00324795 predicted 962
11 SASI_Mm01_00151490 predicted 561
12 SASI_Mm01_00151491 predicted 218
13 SASI_Mm01_00151498 predicted 351
14 SASI_Mm01_00151499 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016948
VALIDATED
PARD6A MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-136s1c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-255s1c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-911s1c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-808s1c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-521s1c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-255s21c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-136s21c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-808s21c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-521s21c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-911s21c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016948
VALIDATED
PARD6A MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-136s1c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-255s1c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-911s1c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-808s1c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-521s1c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-255s21c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-136s21c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-808s21c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-521s21c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-911s21c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016948
VALIDATED
PARD6A MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-136s1c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016948.2-255s1c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-911s1c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-808s1c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016948.2-521s1c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-255s21c1
Sequence:CCGGTGGACGTGCTACTTGGCTATACTCGAGTATAGCCAAGTAGCACGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-136s21c1
Sequence:CCGGCGTCGAGGTGAAGAGCAAATTCTCGAGAATTTGCTCTTCACCTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-808s21c1
Sequence:CCGGCCATAACCTCATTGTCACTGTCTCGAGACAGTGACAATGAGGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-521s21c1
Sequence:CCGGTCAGTCATAGACGTGGACCTACTCGAGTAGGTCCACGTCTATGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016948.2-911s21c1
Sequence:CCGGGCTGAGCCTGATAGTGACGATCTCGAGATCGTCACTATCAGGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019695
VALIDATED
PARD6A MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-718s1c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019695.1-300s1c1
Sequence:CCGGCCTCACCAACGATGACAGTTTCTCGAGAAACTGTCATCGTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-523s1c1
Sequence:CCGGGTTATAGATGTGGACCTACTACTCGAGTAGTAGGTCCACATCTATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-474s1c1
Sequence:CCGGGCCACCCTTGTTAATCAGCTTCTCGAGAAGCTGATTAACAAGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-832s1c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-834s21c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-138s21c1
Sequence:CCGGGTCGAGGTGAAGAGCAAATTTCTCGAGAAATTTGCTCTTCACCTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019695.2-256s21c1
Sequence:CCGGTGGACGTCCTGCTTGGCTATACTCGAGTATAGCCAAGCAGGACGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-418s21c1
Sequence:CCGGCTCTACAAAGGCGCAAGAAAGCTCGAGCTTTCTTGCGCCTTTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-720s21c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019695
VALIDATED
PARD6A MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-718s1c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019695.1-300s1c1
Sequence:CCGGCCTCACCAACGATGACAGTTTCTCGAGAAACTGTCATCGTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-523s1c1
Sequence:CCGGGTTATAGATGTGGACCTACTACTCGAGTAGTAGGTCCACATCTATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-474s1c1
Sequence:CCGGGCCACCCTTGTTAATCAGCTTCTCGAGAAGCTGATTAACAAGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-832s1c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-834s21c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-138s21c1
Sequence:CCGGGTCGAGGTGAAGAGCAAATTTCTCGAGAAATTTGCTCTTCACCTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019695.2-256s21c1
Sequence:CCGGTGGACGTCCTGCTTGGCTATACTCGAGTATAGCCAAGCAGGACGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-418s21c1
Sequence:CCGGCTCTACAAAGGCGCAAGAAAGCTCGAGCTTTCTTGCGCCTTTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-720s21c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019695
VALIDATED
PARD6A MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-718s1c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019695.1-300s1c1
Sequence:CCGGCCTCACCAACGATGACAGTTTCTCGAGAAACTGTCATCGTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-523s1c1
Sequence:CCGGGTTATAGATGTGGACCTACTACTCGAGTAGTAGGTCCACATCTATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-474s1c1
Sequence:CCGGGCCACCCTTGTTAATCAGCTTCTCGAGAAGCTGATTAACAAGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019695.1-832s1c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-834s21c1
Sequence:CCGGCCTGCCAACCAGCGTAATAATCTCGAGATTATTACGCTGGTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-138s21c1
Sequence:CCGGGTCGAGGTGAAGAGCAAATTTCTCGAGAAATTTGCTCTTCACCTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019695.2-256s21c1
Sequence:CCGGTGGACGTCCTGCTTGGCTATACTCGAGTATAGCCAAGCAGGACGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-418s21c1
Sequence:CCGGCTCTACAAAGGCGCAAGAAAGCTCGAGCTTTCTTGCGCCTTTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019695.2-720s21c1
Sequence:CCGGGCGGTCAGTGATGAGATCCTTCTCGAGAAGGATCTCATCACTGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)