EMAIL THIS PAGE TO A FRIEND

PARD6G

par-6 family cell polarity regulator gamma

49 Gene Product Result for
Synonyms: PAR-6G PAR6gamma
UniProtKB ID: Q9BYG4, A8QM57
Gene ID:
Mouse(93737) par-6 partitioning defective 6 homolog gamma (C. elegans)
Rat(307237) par-6 partitioning defective 6 homolog gamma (C. elegans)
sheep(101121649) par-6 partitioning defective 6 homolog gamma (C. elegans)
domestic guinea pig(100728300) par-6 partitioning defective 6 homolog gamma (C. elegans)
chicken(428511) par-6 partitioning defective 6 homolog gamma (C. elegans)
cow(539292) par-6 partitioning defective 6 homolog gamma (C. elegans)
dog(483923) par-6 partitioning defective 6 homolog gamma (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029191 MISSION® esiRNA esiRNA targeting mouse Pard6g (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032510 Rosetta Predictions human pricing
NM_001100973 Rosetta Predictions rat pricing
NM_053117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019122 predicted 827
2 SASI_Hs01_00019123 predicted 325
3 SASI_Hs02_00360001 predicted 655
4 SASI_Hs01_00019124 predicted 857
5 SASI_Hs01_00019126 predicted 346
6 SASI_Hs02_00360002 predicted 379
7 SASI_Hs02_00360003 predicted 323
8 SASI_Hs01_00019127 predicted 1417
9 SASI_Hs01_00019128 predicted 181
10 SASI_Hs01_00019130 predicted 1722
11 SASI_Hs01_00019125 predicted 312
12 SASI_Hs01_00019129 predicted 1500
13 SASI_Hs01_00019131 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210872 predicted 905
2 SASI_Rn02_00210873 predicted 654
3 SASI_Rn02_00210874 predicted 490
4 SASI_Rn02_00210875 predicted 655
5 SASI_Rn02_00210876 predicted 291
6 SASI_Rn02_00210877 predicted 472
7 SASI_Rn02_00210878 predicted 729
8 SASI_Rn02_00210879 predicted 562
9 SASI_Rn02_00210880 predicted 849
10 SASI_Rn02_00210881 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070674 predicted 1324
2 SASI_Mm02_00337625 predicted 1341
3 SASI_Mm01_00070676 predicted 688
4 SASI_Mm01_00070677 predicted 1257
5 SASI_Mm01_00070678 predicted 613
6 SASI_Mm01_00070679 predicted 330
7 SASI_Mm01_00070680 predicted 1446
8 SASI_Mm01_00070681 predicted 1119
9 SASI_Mm02_00337626 predicted 1337
10 SASI_Mm01_00070682 predicted 1367
11 SASI_Mm01_00070673 predicted 1241
12 SASI_Mm01_00070675 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032510
VALIDATED
PARD6G MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator gamma
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-221s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-1407s1c1
Sequence:CCGGCGCTGCTCTTTGTTTCAACTTCTCGAGAAGTTGAAACAAAGAGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-337s1c1
Sequence:CCGGCAGTGATGTAACTATTGGCTACTCGAGTAGCCAATAGTTACATCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032510.2-384s1c1
Sequence:CCGGCCATCAACAATGATGACAACTCTCGAGAGTTGTCATCATTGTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032510.2-293s1c1
Sequence:CCGGGAAGATTTCTACAAGCTGGTTCTCGAGAACCAGCTTGTAGAAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-2583s1c1
Sequence:CCGGGCACCTGTGTTTGATGTTATTCTCGAGAATAACATCAAACACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-310s21c1
Sequence:CCGGGGTTGTGCACACCCACCATATCTCGAGATATGGTGGGTGTGCACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-259s21c1
Sequence:CCGGGTTCTCTCTGGACCGTCATAACTCGAGTTATGACGGTCCAGAGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1358s21c1
Sequence:CCGGGCAGACTGCATCCGCTCATTTCTCGAGAAATGAGCGGATGCAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1669s21c1
Sequence:CCGGAGTTGGCCCATGCAACATATCCTCGAGGATATGTTGCATGGGCCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-195s21c1
Sequence:CCGGCCTTGCGATTCTACGATTGCACTCGAGTGCAATCGTAGAATCGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-411s21c1
Sequence:CCGGAGGCGGTTTCTAGTGCAAATCCTCGAGGATTTGCACTAGAAACCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-793s21c1
Sequence:CCGGGCTGGCTGTGAATGACGAGGTCTCGAGACCTCGTCATTCACAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-816s21c1
Sequence:CCGGTGGAGGTGAACGGCATTGAGGCTCGAGCCTCAATGCCGTTCACCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-1056s21c1
Sequence:CCGGAGGACAACGACGTCGTCATCGCTCGAGCGATGACGACGTCGTTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032510
VALIDATED
PARD6G MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator gamma
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-221s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-1407s1c1
Sequence:CCGGCGCTGCTCTTTGTTTCAACTTCTCGAGAAGTTGAAACAAAGAGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-337s1c1
Sequence:CCGGCAGTGATGTAACTATTGGCTACTCGAGTAGCCAATAGTTACATCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032510.2-384s1c1
Sequence:CCGGCCATCAACAATGATGACAACTCTCGAGAGTTGTCATCATTGTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032510.2-293s1c1
Sequence:CCGGGAAGATTTCTACAAGCTGGTTCTCGAGAACCAGCTTGTAGAAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-2583s1c1
Sequence:CCGGGCACCTGTGTTTGATGTTATTCTCGAGAATAACATCAAACACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-310s21c1
Sequence:CCGGGGTTGTGCACACCCACCATATCTCGAGATATGGTGGGTGTGCACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-259s21c1
Sequence:CCGGGTTCTCTCTGGACCGTCATAACTCGAGTTATGACGGTCCAGAGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1358s21c1
Sequence:CCGGGCAGACTGCATCCGCTCATTTCTCGAGAAATGAGCGGATGCAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1669s21c1
Sequence:CCGGAGTTGGCCCATGCAACATATCCTCGAGGATATGTTGCATGGGCCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-195s21c1
Sequence:CCGGCCTTGCGATTCTACGATTGCACTCGAGTGCAATCGTAGAATCGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-411s21c1
Sequence:CCGGAGGCGGTTTCTAGTGCAAATCCTCGAGGATTTGCACTAGAAACCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-793s21c1
Sequence:CCGGGCTGGCTGTGAATGACGAGGTCTCGAGACCTCGTCATTCACAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-816s21c1
Sequence:CCGGTGGAGGTGAACGGCATTGAGGCTCGAGCCTCAATGCCGTTCACCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-1056s21c1
Sequence:CCGGAGGACAACGACGTCGTCATCGCTCGAGCGATGACGACGTCGTTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032510
VALIDATED
PARD6G MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator gamma
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-221s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-1407s1c1
Sequence:CCGGCGCTGCTCTTTGTTTCAACTTCTCGAGAAGTTGAAACAAAGAGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032510.2-337s1c1
Sequence:CCGGCAGTGATGTAACTATTGGCTACTCGAGTAGCCAATAGTTACATCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032510.2-384s1c1
Sequence:CCGGCCATCAACAATGATGACAACTCTCGAGAGTTGTCATCATTGTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032510.2-293s1c1
Sequence:CCGGGAAGATTTCTACAAGCTGGTTCTCGAGAACCAGCTTGTAGAAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032510.2-2583s1c1
Sequence:CCGGGCACCTGTGTTTGATGTTATTCTCGAGAATAACATCAAACACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-310s21c1
Sequence:CCGGGGTTGTGCACACCCACCATATCTCGAGATATGGTGGGTGTGCACAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-259s21c1
Sequence:CCGGGTTCTCTCTGGACCGTCATAACTCGAGTTATGACGGTCCAGAGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1358s21c1
Sequence:CCGGGCAGACTGCATCCGCTCATTTCTCGAGAAATGAGCGGATGCAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032510.3-1669s21c1
Sequence:CCGGAGTTGGCCCATGCAACATATCCTCGAGGATATGTTGCATGGGCCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-195s21c1
Sequence:CCGGCCTTGCGATTCTACGATTGCACTCGAGTGCAATCGTAGAATCGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-411s21c1
Sequence:CCGGAGGCGGTTTCTAGTGCAAATCCTCGAGGATTTGCACTAGAAACCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-793s21c1
Sequence:CCGGGCTGGCTGTGAATGACGAGGTCTCGAGACCTCGTCATTCACAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-816s21c1
Sequence:CCGGTGGAGGTGAACGGCATTGAGGCTCGAGCCTCAATGCCGTTCACCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032510.3-1056s21c1
Sequence:CCGGAGGACAACGACGTCGTCATCGCTCGAGCGATGACGACGTCGTTGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053117
PARD6G MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053117.2-2103s1c1
Sequence:CCGGCGTGGGTGAATGTGCATGTTACTCGAGTAACATGCACATTCACCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-334s1c1
Sequence:CCGGGCCCATCAACAATGACGACAACTCGAGTTGTCGTCATTGTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-173s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-1004s1c1
Sequence:CCGGGAAGCCGACATTGTCATTGAACTCGAGTTCAATGACAATGTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-689s1c1
Sequence:CCGGCCAGGTATCTTCATTTCTCGACTCGAGTCGAGAAATGAAGATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-655s21c1
Sequence:CCGGGGCTCTACAGACACGGTTATGCTCGAGCATAACCGTGTCTGTAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1512s21c1
Sequence:CCGGCATCATTCCTACAACCTTATTCTCGAGAATAAGGTTGTAGGAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1403s21c1
Sequence:CCGGGCATGTAGTACTGTTAGATATCTCGAGATATCTAACAGTACTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-448s21c1
Sequence:CCGGTTCGAGTCTTCATCCAGAAACCTCGAGGTTTCTGGATGAAGACTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053117
PARD6G MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053117.2-2103s1c1
Sequence:CCGGCGTGGGTGAATGTGCATGTTACTCGAGTAACATGCACATTCACCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-334s1c1
Sequence:CCGGGCCCATCAACAATGACGACAACTCGAGTTGTCGTCATTGTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-173s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-1004s1c1
Sequence:CCGGGAAGCCGACATTGTCATTGAACTCGAGTTCAATGACAATGTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-689s1c1
Sequence:CCGGCCAGGTATCTTCATTTCTCGACTCGAGTCGAGAAATGAAGATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-655s21c1
Sequence:CCGGGGCTCTACAGACACGGTTATGCTCGAGCATAACCGTGTCTGTAGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1512s21c1
Sequence:CCGGCATCATTCCTACAACCTTATTCTCGAGAATAAGGTTGTAGGAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1403s21c1
Sequence:CCGGGCATGTAGTACTGTTAGATATCTCGAGATATCTAACAGTACTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-448s21c1
Sequence:CCGGTTCGAGTCTTCATCCAGAAACCTCGAGGTTTCTGGATGAAGACTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053117
PARD6G MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053117.2-2103s1c1
Sequence:CCGGCGTGGGTGAATGTGCATGTTACTCGAGTAACATGCACATTCACCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-334s1c1
Sequence:CCGGGCCCATCAACAATGACGACAACTCGAGTTGTCGTCATTGTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-173s1c1
Sequence:CCGGGTGGAAGTCAAGAGCAAGTTTCTCGAGAAACTTGCTCTTGACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-1004s1c1
Sequence:CCGGGAAGCCGACATTGTCATTGAACTCGAGTTCAATGACAATGTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053117.2-689s1c1
Sequence:CCGGCCAGGTATCTTCATTTCTCGACTCGAGTCGAGAAATGAAGATACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-655s21c1
Sequence:CCGGGGCTCTACAGACACGGTTATGCTCGAGCATAACCGTGTCTGTAGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1512s21c1
Sequence:CCGGCATCATTCCTACAACCTTATTCTCGAGAATAAGGTTGTAGGAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053117.3-1403s21c1
Sequence:CCGGGCATGTAGTACTGTTAGATATCTCGAGATATCTAACAGTACTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053117.3-448s21c1
Sequence:CCGGTTCGAGTCTTCATCCAGAAACCTCGAGGTTTCTGGATGAAGACTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)