EMAIL THIS PAGE TO A FRIEND

PARK7

parkinson protein 7

67 Gene Product Result for
Synonyms: DJ-1 DJ1
UniProtKB ID: Q99497, B2R4Z1, O14805, Q6DR95, Q7LFU2
Gene ID:
Human(11315) Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(57320) Parkinson disease (autosomal recessive, early onset) 7
Rat(117287) parkinson protein 7
Zebrafish(449674) parkinson disease (autosomal recessive, early onset) 7
chicken(395277) Parkinson disease (autosomal recessive, early onset) 7
dog(479595) parkinson protein 7
cow(511268) parkinson protein 7
domestic cat(101092868) parkinson protein 7
domestic guinea pig(100723185) parkinson protein 7
naked mole-rat(101723322) parkinson protein 7
sheep(101119489) parkinson protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500248 Anti-DJ-1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306166 ANTI-DJ-1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
P9373 Anti-PARK7 (DJ-1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB2108194 Anti-PARK7 antibody produced in rabbit affinity isolated antibody dog, mouse, horse, pig, human, bovine, rat
immunohistochemistry, western blot pricing
HPA004190 Anti-PARK7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2101719 Anti-PARK7 antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, mouse, rabbit, canine, human, pig, chicken, bovine, rat
western blot pricing
SAB4500249 Anti-PARK7 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2500750 Anti-PARK7/DJ-1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
D2943 Monoclonal Anti-PARK7 (DJ-1) antibody produced in mouse ~2 mg/mL, clone E2.1, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1625 Human Park7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123377 Rosetta Predictions human pricing
NM_007262 Rosetta Predictions human pricing
NM_057143 Rosetta Predictions rat pricing
NM_020569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327846 predicted 587
2 SASI_Hs02_00327847 predicted 508
3 SASI_Hs02_00327848 predicted 343
4 SASI_Hs02_00327849 predicted 587
5 SASI_Hs02_00327850 predicted 424
6 SASI_Hs02_00327851 predicted 518
7 SASI_Hs02_00327852 predicted 409
8 SASI_Hs02_00327853 predicted 413
9 SASI_Hs02_00327854 predicted 338
10 SASI_Hs02_00327855 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050045 predicted 637
2 SASI_Hs01_00050046 predicted 564
3 SASI_Hs01_00050048 predicted 396
4 SASI_Hs01_00050049 predicted 642
5 SASI_Hs02_00343294 predicted 486
6 SASI_Hs01_00050050 predicted 571
7 SASI_Hs01_00050051 predicted 468
8 SASI_Hs01_00050052 predicted 471
9 SASI_Hs02_00343295 predicted 397
10 SASI_Hs02_00343296 predicted 708
11 SASI_Hs01_00050044 predicted 303
12 SASI_Hs01_00050047 predicted 414
13 SASI_Hs01_00050053 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108276 predicted 809
2 SASI_Rn01_00108277 predicted 668
3 SASI_Rn01_00108278 predicted 436
4 SASI_Rn01_00108279 predicted 449
5 SASI_Rn01_00108280 predicted 647
6 SASI_Rn01_00108281 predicted 450
7 SASI_Rn01_00108282 predicted 445
8 SASI_Rn01_00108283 predicted 497
9 SASI_Rn01_00108284 predicted 544
10 SASI_Rn01_00108285 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178496 predicted 509
2 SASI_Mm01_00178497 predicted 286
3 SASI_Mm01_00178498 predicted 302
4 SASI_Mm01_00178499 predicted 346
5 SASI_Mm01_00178500 predicted 389
6 SASI_Mm01_00178501 predicted 468
7 SASI_Mm01_00178502 predicted 563
8 SASI_Mm01_00178503 predicted 369
9 SASI_Mm02_00325620 predicted 312
10 SASI_Mm01_00178504 predicted 398
11 SASI_Mm01_00178495 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020569
VALIDATED
PARK7 MISSION shRNA Bacterial Glycerol Stock
parkinson protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-640s21c1
Sequence:CCGGTTGAGTTTGCACTAGCCATTGCTCGAGCAATGGCTAGTGCAAACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-745s21c1
Sequence:CCGGACGCTTGAGCAGGCATTGGAACTCGAGTTCCAATGCCTGCTCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-700s21c1
Sequence:CCGGAGGCACCGCTTGTTCTCAAAGCTCGAGCTTTGAGAACAAGCGGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-293s21c1
Sequence:CCGGTAGCCGTGATGTAATGATTTGCTCGAGCAAATCATTACATCACGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-382s21c1
Sequence:CCGGATCTGGGTGCACAGAATTTATCTCGAGATAAATTCTGTGCACCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-244s1c1
Sequence:CCGGCGTGATGTAATGATTTGTCCACTCGAGTGGACAAATCATTACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-298s1c1
Sequence:CCGGCCATACGATGTGGTGGTTCTTCTCGAGAAGAACCACCACATCGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-580s1c1
Sequence:CCGGACCAGCTTTGAGTTTGCACTACTCGAGTAGTGCAAACTCAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-187s1c1
Sequence:CCGGGCCGGGATCAAAGTCACTGTTCTCGAGAACAGTGACTTTGATCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-341s1c1
Sequence:CCGGAGAATTTATCTGAGTCGCCTACTCGAGTAGGCGACTCAGATAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020569
VALIDATED
PARK7 MISSION shRNA shRNA Plasmid DNA
parkinson protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-640s21c1
Sequence:CCGGTTGAGTTTGCACTAGCCATTGCTCGAGCAATGGCTAGTGCAAACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-745s21c1
Sequence:CCGGACGCTTGAGCAGGCATTGGAACTCGAGTTCCAATGCCTGCTCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-700s21c1
Sequence:CCGGAGGCACCGCTTGTTCTCAAAGCTCGAGCTTTGAGAACAAGCGGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-293s21c1
Sequence:CCGGTAGCCGTGATGTAATGATTTGCTCGAGCAAATCATTACATCACGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-382s21c1
Sequence:CCGGATCTGGGTGCACAGAATTTATCTCGAGATAAATTCTGTGCACCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-244s1c1
Sequence:CCGGCGTGATGTAATGATTTGTCCACTCGAGTGGACAAATCATTACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-298s1c1
Sequence:CCGGCCATACGATGTGGTGGTTCTTCTCGAGAAGAACCACCACATCGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-580s1c1
Sequence:CCGGACCAGCTTTGAGTTTGCACTACTCGAGTAGTGCAAACTCAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-187s1c1
Sequence:CCGGGCCGGGATCAAAGTCACTGTTCTCGAGAACAGTGACTTTGATCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-341s1c1
Sequence:CCGGAGAATTTATCTGAGTCGCCTACTCGAGTAGGCGACTCAGATAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020569
VALIDATED
PARK7 MISSION shRNA Lentiviral Transduction Particles
parkinson protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-640s21c1
Sequence:CCGGTTGAGTTTGCACTAGCCATTGCTCGAGCAATGGCTAGTGCAAACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-745s21c1
Sequence:CCGGACGCTTGAGCAGGCATTGGAACTCGAGTTCCAATGCCTGCTCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-700s21c1
Sequence:CCGGAGGCACCGCTTGTTCTCAAAGCTCGAGCTTTGAGAACAAGCGGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-293s21c1
Sequence:CCGGTAGCCGTGATGTAATGATTTGCTCGAGCAAATCATTACATCACGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020569.3-382s21c1
Sequence:CCGGATCTGGGTGCACAGAATTTATCTCGAGATAAATTCTGTGCACCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-244s1c1
Sequence:CCGGCGTGATGTAATGATTTGTCCACTCGAGTGGACAAATCATTACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-298s1c1
Sequence:CCGGCCATACGATGTGGTGGTTCTTCTCGAGAAGAACCACCACATCGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020569.1-580s1c1
Sequence:CCGGACCAGCTTTGAGTTTGCACTACTCGAGTAGTGCAAACTCAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-187s1c1
Sequence:CCGGGCCGGGATCAAAGTCACTGTTCTCGAGAACAGTGACTTTGATCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020569.1-341s1c1
Sequence:CCGGAGAATTTATCTGAGTCGCCTACTCGAGTAGGCGACTCAGATAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007262
VALIDATED
PARK7 MISSION shRNA Bacterial Glycerol Stock
parkinson protein 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000004918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-583s1c1
Sequence:CCGGGCAATTGTTGAAGCCCTGAATCTCGAGATTCAGGGCTTCAACAATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007262.3-169s1c1
Sequence:CCGGGCTGGGATTAAGGTCACCGTTCTCGAGAACGGTGACCTTAATCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-221s1c1
Sequence:CCGGGTAGCCGTGATGTGGTCATTTCTCGAGAAATGACCACATCACGGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-506s1c1
Sequence:CCGGACTCTGAGAATCGTGTGGAAACTCGAGTTTCCACACGATTCTCAGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007262
VALIDATED
PARK7 MISSION shRNA shRNA Plasmid DNA
parkinson protein 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000004918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-583s1c1
Sequence:CCGGGCAATTGTTGAAGCCCTGAATCTCGAGATTCAGGGCTTCAACAATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007262.3-169s1c1
Sequence:CCGGGCTGGGATTAAGGTCACCGTTCTCGAGAACGGTGACCTTAATCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-221s1c1
Sequence:CCGGGTAGCCGTGATGTGGTCATTTCTCGAGAAATGACCACATCACGGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-506s1c1
Sequence:CCGGACTCTGAGAATCGTGTGGAAACTCGAGTTTCCACACGATTCTCAGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007262
VALIDATED
PARK7 MISSION shRNA Lentiviral Transduction Particles
parkinson protein 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000004918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-583s1c1
Sequence:CCGGGCAATTGTTGAAGCCCTGAATCTCGAGATTCAGGGCTTCAACAATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007262.3-169s1c1
Sequence:CCGGGCTGGGATTAAGGTCACCGTTCTCGAGAACGGTGACCTTAATCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-221s1c1
Sequence:CCGGGTAGCCGTGATGTGGTCATTTCTCGAGAAATGACCACATCACGGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007262.3-506s1c1
Sequence:CCGGACTCTGAGAATCGTGTGGAAACTCGAGTTTCCACACGATTCTCAGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)