EMAIL THIS PAGE TO A FRIEND

PARL

presenilin associated, rhomboid-like

70 Gene Product Result for
Synonyms: PSARL PSARL1 PSENIP2 RHBDS1
UniProtKB ID: Q9H300, Q96CQ4, Q9BTJ6, Q9P1E3
Gene ID:
Human(55486) Summary: This gene encodes a mitochondrial integral membrane protein. Following proteolytic processing of this protein, a small peptide (P-beta) is formed and translocated to the nucleus. This gene may be involved in signal transduction via regulated intramembrane proteolysis of membrane-tethered precursor proteins. Variation in this gene has been associated with increased risk for type 2 diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(381038) presenilin associated, rhomboid-like
Rat(287979) presenilin associated, rhomboid-like
sheep(101102026) presenilin associated, rhomboid-like
naked mole-rat(101719514) presenilin associated, rhomboid-like
Domestic Rabbit(100351338) presenilin associated, rhomboid-like
domestic guinea pig(100722572) presenilin associated, rhomboid-like
chicken(424767) presenilin associated, rhomboid-like
cow(514191) presenilin associated, rhomboid-like
Horse(100058851) presenilin associated, rhomboid-like
domestic cat(101091042) presenilin associated, rhomboid-like
dog(488100) presenilin associated, rhomboid-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037639 Rosetta Predictions human pricing
NM_018622 Rosetta Predictions human pricing
NM_001035249 Rosetta Predictions rat pricing
NM_001005767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308338 predicted 224
2 SASI_Hs01_00093038 predicted 383
3 SASI_Hs01_00093039 predicted 398
4 SASI_Hs01_00093040 predicted 335
5 SASI_Hs01_00093041 predicted 234
6 SASI_Hs01_00093042 predicted 940
7 SASI_Hs02_00308339 predicted 403
8 SASI_Hs02_00308340 predicted 371
9 SASI_Hs01_00093045 predicted 325
10 SASI_Hs01_00093046 predicted 385
11 SASI_Hs01_00093043 predicted 869
12 SASI_Hs01_00093044 predicted 282
13 SASI_Hs01_00093047 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352130 predicted 222
2 SASI_Hs01_00094801 predicted 385
3 SASI_Hs01_00094802 predicted 404
4 SASI_Hs01_00094803 predicted 330
5 SASI_Hs01_00094804 predicted 234
6 SASI_Hs01_00094805 predicted 1085
7 SASI_Hs02_00352131 predicted 406
8 SASI_Hs02_00352132 predicted 373
9 SASI_Hs01_00094808 predicted 324
10 SASI_Hs01_00094809 predicted 379
11 SASI_Hs01_00094806 predicted 1028
12 SASI_Hs01_00094807 predicted 278
13 SASI_Hs01_00094810 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204197 predicted 382
2 SASI_Rn02_00204198 predicted 563
3 SASI_Rn02_00204199 predicted 998
4 SASI_Rn02_00204200 predicted 490
5 SASI_Rn02_00204201 predicted 672
6 SASI_Rn02_00204202 predicted 1063
7 SASI_Rn02_00204203 predicted 519
8 SASI_Rn02_00204204 predicted 314
9 SASI_Rn02_00204205 predicted 598
10 SASI_Rn02_00204206 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144530 predicted 658
2 SASI_Mm02_00286646 predicted 669
3 SASI_Mm01_00144533 predicted 634
4 SASI_Mm01_00144534 predicted 770
5 SASI_Mm01_00144538 predicted 667
6 SASI_Mm02_00286647 predicted 754
7 SASI_Mm02_00286648 predicted 306
8 SASI_Mm02_00286649 predicted 724
9 SASI_Mm02_00286650 predicted 644
10 SASI_Mm02_00286651 predicted 308
11 SASI_Mm01_00144529 predicted 1000
12 SASI_Mm01_00144531 predicted 594
13 SASI_Mm01_00144532 predicted 487
14 SASI_Mm01_00144535 predicted 516
15 SASI_Mm01_00144536 predicted 250
16 SASI_Mm01_00144537 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018622
VALIDATED
PARL MISSION shRNA Bacterial Glycerol Stock
presenilin associated, rhomboid-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-596s1c1
Sequence:CCGGGCGGACAATGATCAGATATTTCTCGAGAAATATCTGATCATTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018622.3-150s1c1
Sequence:CCGGCGCAGGTTTAACTTCTTTATTCTCGAGAATAAAGAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-826s1c1
Sequence:CCGGCCACAGGAAGATATGGACCATCTCGAGATGGTCCATATCTTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-528s1c1
Sequence:CCGGCGGACTGTGACAGGTATTATACTCGAGTATAATACCTGTCACAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-375s1c1
Sequence:CCGGGCTGCTATTTGGCAATATGAACTCGAGTTCATATTGCCAAATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1011s21c1
Sequence:CCGGATGGATACAGCAGGAATGATCCTCGAGGATCATTCCTGCTGTATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-669s21c1
Sequence:CCGGGTCCTTTGTTCTCCAATGTTGCTCGAGCAACATTGGAGAACAAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1099s21c1
Sequence:CCGGCTTACGGTCATGAACTGATTTCTCGAGAAATCAGTTCATGACCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018622
VALIDATED
PARL MISSION shRNA shRNA Plasmid DNA
presenilin associated, rhomboid-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-596s1c1
Sequence:CCGGGCGGACAATGATCAGATATTTCTCGAGAAATATCTGATCATTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018622.3-150s1c1
Sequence:CCGGCGCAGGTTTAACTTCTTTATTCTCGAGAATAAAGAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-826s1c1
Sequence:CCGGCCACAGGAAGATATGGACCATCTCGAGATGGTCCATATCTTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-528s1c1
Sequence:CCGGCGGACTGTGACAGGTATTATACTCGAGTATAATACCTGTCACAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-375s1c1
Sequence:CCGGGCTGCTATTTGGCAATATGAACTCGAGTTCATATTGCCAAATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1011s21c1
Sequence:CCGGATGGATACAGCAGGAATGATCCTCGAGGATCATTCCTGCTGTATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-669s21c1
Sequence:CCGGGTCCTTTGTTCTCCAATGTTGCTCGAGCAACATTGGAGAACAAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1099s21c1
Sequence:CCGGCTTACGGTCATGAACTGATTTCTCGAGAAATCAGTTCATGACCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018622
VALIDATED
PARL MISSION shRNA Lentiviral Transduction Particles
presenilin associated, rhomboid-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-596s1c1
Sequence:CCGGGCGGACAATGATCAGATATTTCTCGAGAAATATCTGATCATTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018622.3-150s1c1
Sequence:CCGGCGCAGGTTTAACTTCTTTATTCTCGAGAATAAAGAAGTTAAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-826s1c1
Sequence:CCGGCCACAGGAAGATATGGACCATCTCGAGATGGTCCATATCTTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-528s1c1
Sequence:CCGGCGGACTGTGACAGGTATTATACTCGAGTATAATACCTGTCACAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018622.3-375s1c1
Sequence:CCGGGCTGCTATTTGGCAATATGAACTCGAGTTCATATTGCCAAATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1011s21c1
Sequence:CCGGATGGATACAGCAGGAATGATCCTCGAGGATCATTCCTGCTGTATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-669s21c1
Sequence:CCGGGTCCTTTGTTCTCCAATGTTGCTCGAGCAACATTGGAGAACAAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018622.5-1099s21c1
Sequence:CCGGCTTACGGTCATGAACTGATTTCTCGAGAAATCAGTTCATGACCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005767
VALIDATED
PARL MISSION shRNA Bacterial Glycerol Stock
presenilin associated, rhomboid-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-597s1c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-150s1c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-659s1c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-1177s1c1
Sequence:CCGGCTGGCCAGTATGACGGTGCATCTCGAGATGCACCGTCATACTGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-628s1c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-659s21c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-597s21c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-628s21c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-150s21c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005767
VALIDATED
PARL MISSION shRNA shRNA Plasmid DNA
presenilin associated, rhomboid-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-597s1c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-150s1c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-659s1c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-1177s1c1
Sequence:CCGGCTGGCCAGTATGACGGTGCATCTCGAGATGCACCGTCATACTGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-628s1c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-659s21c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-597s21c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-628s21c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-150s21c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005767
VALIDATED
PARL MISSION shRNA Lentiviral Transduction Particles
presenilin associated, rhomboid-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-597s1c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-150s1c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-659s1c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-1177s1c1
Sequence:CCGGCTGGCCAGTATGACGGTGCATCTCGAGATGCACCGTCATACTGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005767.1-628s1c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-659s21c1
Sequence:CCGGGCTGTCAACGTTCAGTCATTTCTCGAGAAATGACTGAACGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-597s21c1
Sequence:CCGGCGAACCATGATCAGATACTTTCTCGAGAAAGTATCTGATCATGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-628s21c1
Sequence:CCGGCAGCATCCAAGGTTCTTTGTTCTCGAGAACAAAGAACCTTGGATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005767.4-150s21c1
Sequence:CCGGCGCAGGTTTAACTTGTTTGTTCTCGAGAACAAACAAGTTAAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)