EMAIL THIS PAGE TO A FRIEND

PARN

poly(A)-specific ribonuclease

63 Gene Product Result for
Synonyms: DAN
UniProtKB ID: O95453, B2RCB3, B4DDG8, B4DWR4, B4E1H6
Gene ID:
Human(5073) Summary: The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(74108) poly(A)-specific ribonuclease (deadenylation nuclease)
Rat(360464) poly(A)-specific ribonuclease
sheep(101112185) poly(A)-specific ribonuclease
naked mole-rat(101715275) poly(A)-specific ribonuclease
Domestic Rabbit(100351489) poly(A)-specific ribonuclease
domestic guinea pig(100732149) poly(A)-specific ribonuclease
Zebrafish(791461) poly(A)-specific ribonuclease (deadenylation nuclease)
cow(524155) poly(A)-specific ribonuclease
chicken(416423) poly(A)-specific ribonuclease
domestic cat(101100021) poly(A)-specific ribonuclease
dog(479839) poly(A)-specific ribonuclease
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002582 Rosetta Predictions human pricing
XM_001075629 Rosetta Predictions rat pricing
XM_340740 Rosetta Predictions rat pricing
NM_028761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023171 predicted 1749
2 SASI_Hs02_00334079 predicted 757
3 SASI_Hs01_00023172 predicted 895
4 SASI_Hs02_00334080 predicted 698
5 SASI_Hs02_00334081 predicted 727
6 SASI_Hs01_00023173 predicted 1234
7 SASI_Hs01_00023177 predicted 205
8 SASI_Hs01_00023178 predicted 1320
9 SASI_Hs01_00023179 predicted 1484
10 SASI_Hs01_00023180 predicted 1519
11 SASI_Hs01_00023174 predicted 317
12 SASI_Hs01_00023175 predicted 1017
13 SASI_Hs01_00023176 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350486 predicted 249
2 SASI_Rn02_00350487 predicted 678
3 SASI_Rn02_00350488 predicted 1469
4 SASI_Rn02_00350489 predicted 772
5 SASI_Rn02_00350490 predicted 1241
6 SASI_Rn02_00350491 predicted 1113
7 SASI_Rn02_00350492 predicted 1409
8 SASI_Rn02_00350493 predicted 348
9 SASI_Rn02_00350494 predicted 1152
10 SASI_Rn02_00350495 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391839 predicted 1523
2 SASI_Rn02_00391840 predicted 1297
3 SASI_Rn02_00391841 predicted 1395
4 SASI_Rn02_00391842 predicted 1688
5 SASI_Rn02_00391843 predicted 1431
6 SASI_Rn02_00391844 predicted 1254
7 SASI_Rn02_00391845 predicted 1982
8 SASI_Rn02_00391846 predicted 1729
9 SASI_Rn02_00391847 predicted 1529
10 SASI_Rn02_00391848 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164451 predicted 252
2 SASI_Mm01_00164452 predicted 757
3 SASI_Mm02_00334350 predicted 821
4 SASI_Mm01_00164453 predicted 1385
5 SASI_Mm01_00164454 predicted 1607
6 SASI_Mm01_00164456 predicted 488
7 SASI_Mm02_00334351 predicted 1297
8 SASI_Mm02_00334352 predicted 1533
9 SASI_Mm01_00164457 predicted 1548
10 SASI_Mm01_00164458 predicted 816
11 SASI_Mm01_00164455 predicted 1951
12 SASI_Mm01_00164459 predicted 1627
13 SASI_Mm01_00164460 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028761
VALIDATED
PARN MISSION shRNA Bacterial Glycerol Stock
poly(A)-specific ribonuclease
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2499s1c1
Sequence:CCGGCAAGTTTCTTTCCCTCAGATACTCGAGTATCTGAGGGAAAGAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028761.1-1042s1c1
Sequence:CCGGCCTGAATGAGTTTAAGGAGATCTCGAGATCTCCTTAAACTCATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-1520s1c1
Sequence:CCGGGCCTTCGGTAACATTCAGATTCTCGAGAATCTGAATGTTACCGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2211s1c1
Sequence:CCGGGCGTGTGTGTTATTAACTAATCTCGAGATTAGTTAATAACACACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-296s1c1
Sequence:CCGGGAGAGATATCAGAAGCTTAAACTCGAGTTTAAGCTTCTGATATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028761
VALIDATED
PARN MISSION shRNA shRNA Plasmid DNA
poly(A)-specific ribonuclease
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2499s1c1
Sequence:CCGGCAAGTTTCTTTCCCTCAGATACTCGAGTATCTGAGGGAAAGAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028761.1-1042s1c1
Sequence:CCGGCCTGAATGAGTTTAAGGAGATCTCGAGATCTCCTTAAACTCATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-1520s1c1
Sequence:CCGGGCCTTCGGTAACATTCAGATTCTCGAGAATCTGAATGTTACCGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2211s1c1
Sequence:CCGGGCGTGTGTGTTATTAACTAATCTCGAGATTAGTTAATAACACACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-296s1c1
Sequence:CCGGGAGAGATATCAGAAGCTTAAACTCGAGTTTAAGCTTCTGATATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028761
VALIDATED
PARN MISSION shRNA Lentiviral Transduction Particles
poly(A)-specific ribonuclease
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2499s1c1
Sequence:CCGGCAAGTTTCTTTCCCTCAGATACTCGAGTATCTGAGGGAAAGAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028761.1-1042s1c1
Sequence:CCGGCCTGAATGAGTTTAAGGAGATCTCGAGATCTCCTTAAACTCATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-1520s1c1
Sequence:CCGGGCCTTCGGTAACATTCAGATTCTCGAGAATCTGAATGTTACCGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-2211s1c1
Sequence:CCGGGCGTGTGTGTTATTAACTAATCTCGAGATTAGTTAATAACACACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028761.1-296s1c1
Sequence:CCGGGAGAGATATCAGAAGCTTAAACTCGAGTTTAAGCTTCTGATATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002582
PARN MISSION shRNA Bacterial Glycerol Stock
poly(A)-specific ribonuclease
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002582.1-2047s1c1
Sequence:CCGGCCGCACTGTATTTAACTTAATCTCGAGATTAAGTTAAATACAGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1739s1c1
Sequence:CCGGCCAGCACAGTAGGAAAGAGAACTCGAGTTCTCTTTCCTACTGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-536s1c1
Sequence:CCGGCCTATGTATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1456s1c1
Sequence:CCGGGCCTTTGGTAACATTCAGATACTCGAGTATCTGAATGTTACCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1015s1c1
Sequence:CCGGCCCAGACTCTTGGATACTAAACTCGAGTTTAGTATCCAAGAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002582
PARN MISSION shRNA shRNA Plasmid DNA
poly(A)-specific ribonuclease
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002582.1-2047s1c1
Sequence:CCGGCCGCACTGTATTTAACTTAATCTCGAGATTAAGTTAAATACAGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1739s1c1
Sequence:CCGGCCAGCACAGTAGGAAAGAGAACTCGAGTTCTCTTTCCTACTGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-536s1c1
Sequence:CCGGCCTATGTATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1456s1c1
Sequence:CCGGGCCTTTGGTAACATTCAGATACTCGAGTATCTGAATGTTACCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1015s1c1
Sequence:CCGGCCCAGACTCTTGGATACTAAACTCGAGTTTAGTATCCAAGAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002582
PARN MISSION shRNA Lentiviral Transduction Particles
poly(A)-specific ribonuclease
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002582.1-2047s1c1
Sequence:CCGGCCGCACTGTATTTAACTTAATCTCGAGATTAAGTTAAATACAGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1739s1c1
Sequence:CCGGCCAGCACAGTAGGAAAGAGAACTCGAGTTCTCTTTCCTACTGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-536s1c1
Sequence:CCGGCCTATGTATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1456s1c1
Sequence:CCGGGCCTTTGGTAACATTCAGATACTCGAGTATCTGAATGTTACCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002582.1-1015s1c1
Sequence:CCGGCCCAGACTCTTGGATACTAAACTCGAGTTTAGTATCCAAGAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)