EMAIL THIS PAGE TO A FRIEND

PARP10

poly (ADP-ribose) polymerase family, member 10

50 Gene Product Result for
Synonyms: ARTD10
UniProtKB ID: Q53GL7, Q8N2I0, Q8WV05, Q96CH7, Q96K72
Gene ID:
Human(84875) Summary: Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]
Mouse(671535) poly (ADP-ribose) polymerase family, member 10
Rat(100362108) poly (ADP-ribose) polymerase family, member 10
sheep(101111201) poly (ADP-ribose) polymerase family, member 10
naked mole-rat(101706912) poly (ADP-ribose) polymerase family, member 10
domestic guinea pig(100732176) poly (ADP-ribose) polymerase family, member 10
domestic cat(101092994) poly (ADP-ribose) polymerase family, member 10
cow(510991) poly (ADP-ribose) polymerase family, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001477922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001477922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001477922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032789 Rosetta Predictions human pricing
XM_001477922 Rosetta Predictions mouse pricing
XM_001477932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042392 predicted 2834
2 SASI_Hs02_00360347 predicted 2490
3 SASI_Hs02_00360348 predicted 2099
4 SASI_Hs01_00042393 predicted 1137
5 SASI_Hs02_00360349 predicted 1764
6 SASI_Hs01_00042395 predicted 1621
7 SASI_Hs01_00042396 predicted 1313
8 SASI_Hs01_00042397 predicted 1087
9 SASI_Hs01_00042398 predicted 1146
10 SASI_Hs01_00042399 predicted 2451
11 SASI_Hs01_00042394 predicted 276
12 SASI_Hs01_00042400 predicted 1524
13 SASI_Hs01_00042401 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399032 predicted 405
2 SASI_Mm02_00399033 predicted 3029
3 SASI_Mm02_00399034 predicted 2023
4 SASI_Mm02_00399035 predicted 2053
5 SASI_Mm02_00399036 predicted 1139
6 SASI_Mm02_00399037 predicted 2993
7 SASI_Mm02_00399038 predicted 3085
8 SASI_Mm02_00399039 predicted 2873
9 SASI_Mm02_00399040 predicted 749
10 SASI_Mm02_00399041 predicted 2780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399090 predicted 302
2 SASI_Mm02_00399091 predicted 2926
3 SASI_Mm02_00399092 predicted 1923
4 SASI_Mm02_00399093 predicted 1952
5 SASI_Mm02_00399094 predicted 1041
6 SASI_Mm02_00399095 predicted 2894
7 SASI_Mm02_00399096 predicted 2989
8 SASI_Mm02_00399097 predicted 2772
9 SASI_Mm02_00399098 predicted 649
10 SASI_Mm02_00399099 predicted 2678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001477922
PARP10 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-2750s21c1
Sequence:CCGGCACGGCTTCAATCGCAGTTTCCTCGAGGAAACTGCGATTGAAGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-375s21c1
Sequence:CCGGCAGATGCAAAGAGGGTCTTAGCTCGAGCTAAGACCCTCTTTGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477922.1-3107s21c1
Sequence:CCGGGGATCTCTTTCCTGGACATTTCTCGAGAAATGTCCAGGAAAGAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1145s21c1
Sequence:CCGGCCAGTTGACTCGGGATCAATTCTCGAGAATTGATCCCGAGTCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1780s21c1
Sequence:CCGGAGTCCTCCATGGCCACATTACCTCGAGGTAATGTGGCCATGGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001477922
PARP10 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-2750s21c1
Sequence:CCGGCACGGCTTCAATCGCAGTTTCCTCGAGGAAACTGCGATTGAAGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-375s21c1
Sequence:CCGGCAGATGCAAAGAGGGTCTTAGCTCGAGCTAAGACCCTCTTTGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477922.1-3107s21c1
Sequence:CCGGGGATCTCTTTCCTGGACATTTCTCGAGAAATGTCCAGGAAAGAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1145s21c1
Sequence:CCGGCCAGTTGACTCGGGATCAATTCTCGAGAATTGATCCCGAGTCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1780s21c1
Sequence:CCGGAGTCCTCCATGGCCACATTACCTCGAGGTAATGTGGCCATGGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001477922
PARP10 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-2750s21c1
Sequence:CCGGCACGGCTTCAATCGCAGTTTCCTCGAGGAAACTGCGATTGAAGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-375s21c1
Sequence:CCGGCAGATGCAAAGAGGGTCTTAGCTCGAGCTAAGACCCTCTTTGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477922.1-3107s21c1
Sequence:CCGGGGATCTCTTTCCTGGACATTTCTCGAGAAATGTCCAGGAAAGAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1145s21c1
Sequence:CCGGCCAGTTGACTCGGGATCAATTCTCGAGAATTGATCCCGAGTCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477922.1-1780s21c1
Sequence:CCGGAGTCCTCCATGGCCACATTACCTCGAGGTAATGTGGCCATGGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032789
VALIDATED
PARP10 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-141s1c2
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032789.1-3157s1c1
Sequence:CCGGCCACCCTCTGGCCTCCTGCTTCTCGAGAAGCAGGAGGCCAGAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1447s1c1
Sequence:CCGGCTCTACCATGAGGACCTTCTTCTCGAGAAGAAGGTCCTCATGGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-141s1c1
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-634s1c1
Sequence:CCGGCTGGAGTTGTACCTGGAGAATCTCGAGATTCTCCAGGTACAACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1681s1c1
Sequence:CCGGGCTCAGTTCCAGTGTGTCTTTCTCGAGAAAGACACACTGGAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032789
VALIDATED
PARP10 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-141s1c2
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032789.1-3157s1c1
Sequence:CCGGCCACCCTCTGGCCTCCTGCTTCTCGAGAAGCAGGAGGCCAGAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1447s1c1
Sequence:CCGGCTCTACCATGAGGACCTTCTTCTCGAGAAGAAGGTCCTCATGGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-141s1c1
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-634s1c1
Sequence:CCGGCTGGAGTTGTACCTGGAGAATCTCGAGATTCTCCAGGTACAACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1681s1c1
Sequence:CCGGGCTCAGTTCCAGTGTGTCTTTCTCGAGAAAGACACACTGGAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032789
VALIDATED
PARP10 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-141s1c2
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032789.1-3157s1c1
Sequence:CCGGCCACCCTCTGGCCTCCTGCTTCTCGAGAAGCAGGAGGCCAGAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1447s1c1
Sequence:CCGGCTCTACCATGAGGACCTTCTTCTCGAGAAGAAGGTCCTCATGGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-141s1c1
Sequence:CCGGCGAGCTGCTCACTCTCTACTTCTCGAGAAGTAGAGAGTGAGCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032789.1-634s1c1
Sequence:CCGGCTGGAGTTGTACCTGGAGAATCTCGAGATTCTCCAGGTACAACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032789.1-1681s1c1
Sequence:CCGGGCTCAGTTCCAGTGTGTCTTTCTCGAGAAAGACACACTGGAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)