EMAIL THIS PAGE TO A FRIEND

PARP11

poly (ADP-ribose) polymerase family, member 11

167 Gene Product Result for
Synonyms: ARTD11 C12orf6
UniProtKB ID: Q9NR21, B4DRQ0, Q68DS1, Q8N5Y9
Gene ID:
Mouse(101187) poly (ADP-ribose) polymerase family, member 11
Rat(500323) poly (ADP-ribose) polymerase family, member 11
chicken(418264) poly (ADP-ribose) polymerase family, member 11
cow(539763) poly (ADP-ribose) polymerase family, member 11
domestic cat(101090702) poly (ADP-ribose) polymerase family, member 11
Horse(100057934) poly (ADP-ribose) polymerase family, member 11
dog(477722) poly (ADP-ribose) polymerase family, member 11
domestic guinea pig(100730318) poly (ADP-ribose) polymerase family, member 11
naked mole-rat(101720295) poly (ADP-ribose) polymerase family, member 11
sheep(101117237) poly (ADP-ribose) polymerase family, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020367 Rosetta Predictions human pricing
XM_575674 Rosetta Predictions rat pricing
NM_181402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173656 predicted 627
2 SASI_Hs02_00353319 predicted 369
3 SASI_Hs01_00173657 predicted 1111
4 SASI_Hs01_00173659 predicted 1108
5 SASI_Hs01_00173660 predicted 608
6 SASI_Hs01_00173661 predicted 1117
7 SASI_Hs01_00173662 predicted 590
8 SASI_Hs01_00173663 predicted 533
9 SASI_Hs01_00173664 predicted 949
10 SASI_Hs01_00173665 predicted 658
11 SASI_Hs01_00173658 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404077 predicted 1140
2 SASI_Rn02_00404078 predicted 1177
3 SASI_Rn02_00404079 predicted 1026
4 SASI_Rn02_00404080 predicted 1521
5 SASI_Rn02_00404081 predicted 1471
6 SASI_Rn02_00404082 predicted 1202
7 SASI_Rn02_00404083 predicted 1379
8 SASI_Rn02_00404084 predicted 1537
9 SASI_Rn02_00404085 predicted 1277
10 SASI_Rn02_00404086 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349741 predicted 680
2 SASI_Mm02_00349742 predicted 931
3 SASI_Mm02_00349743 predicted 541
4 SASI_Mm02_00349744 predicted 1106
5 SASI_Mm02_00349745 predicted 1117
6 SASI_Mm02_00349746 predicted 1054
7 SASI_Mm02_00349747 predicted 1146
8 SASI_Mm02_00349748 predicted 1130
9 SASI_Mm02_00349749 predicted 503
10 SASI_Mm02_00349750 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020367
VALIDATED
PARP11 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 11
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1046s1c1
Sequence:CCGGGACGGGAGCTATGTGAATTTACTCGAGTAAATTCACATAGCTCCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-569s1c1
Sequence:CCGGCCTCTGCACAATCAAACACATCTCGAGATGTGTTTGATTGTGCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1123s1c1
Sequence:CCGGCAACCAAATCTATCCTGAGTACTCGAGTACTCAGGATAGATTTGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020367.x-1020s1c1
Sequence:CCGGCCAAATACATGCGACCTCCTTCTCGAGAAGGAGGTCGCATGTATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1176s1c1
Sequence:CCGGTCTCGGTGGTCAAGGAAGCTTCTCGAGAAGCTTCCTTGACCACCGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-665s21c1
Sequence:CCGGATGAAGTTGCTAATCTCTTTGCTCGAGCAAAGAGATTAGCAACTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1017s21c1
Sequence:CCGGGCATCTGTTTAGAACATATAACTCGAGTTATATGTTCTAAACAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-851s21c1
Sequence:CCGGCAATCTGCATTCATAACTTTGCTCGAGCAAAGTTATGAATGCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-452s21c1
Sequence:CCGGCCAAATTCAGCTACAAGATAGCTCGAGCTATCTTGTAGCTGAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-694s21c1
Sequence:CCGGATGGATCGCAACCGAATTAAACTCGAGTTTAATTCGGTTGCGATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-607s21c1
Sequence:CCGGGTGAATACTCAAGTACCATATCTCGAGATATGGTACTTGAGTATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-288s21c1
Sequence:CCGGTGACATGGACACGTCAGATACCTCGAGGTATCTGACGTGTCCATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1058s21c1
Sequence:CCGGTGCTAATTGGAGATTACATAACTCGAGTTATGTAATCTCCAATTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-505s21c1
Sequence:CCGGACTGGAAAGCAGCGCTTAATACTCGAGTATTAAGCGCTGCTTTCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1497s21c1
Sequence:CCGGATCAGCTGAGTCTCAACTAATCTCGAGATTAGTTGAGACTCAGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1614s21c1
Sequence:CCGGAGACATAAATGTGTCCCTTTACTCGAGTAAAGGGACACATTTATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-795s21c1
Sequence:CCGGGCCTCAGATTAATGAACAAATCTCGAGATTTGTTCATTAATCTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020367
VALIDATED
PARP11 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 11
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1046s1c1
Sequence:CCGGGACGGGAGCTATGTGAATTTACTCGAGTAAATTCACATAGCTCCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-569s1c1
Sequence:CCGGCCTCTGCACAATCAAACACATCTCGAGATGTGTTTGATTGTGCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1123s1c1
Sequence:CCGGCAACCAAATCTATCCTGAGTACTCGAGTACTCAGGATAGATTTGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020367.x-1020s1c1
Sequence:CCGGCCAAATACATGCGACCTCCTTCTCGAGAAGGAGGTCGCATGTATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1176s1c1
Sequence:CCGGTCTCGGTGGTCAAGGAAGCTTCTCGAGAAGCTTCCTTGACCACCGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-665s21c1
Sequence:CCGGATGAAGTTGCTAATCTCTTTGCTCGAGCAAAGAGATTAGCAACTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1017s21c1
Sequence:CCGGGCATCTGTTTAGAACATATAACTCGAGTTATATGTTCTAAACAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-851s21c1
Sequence:CCGGCAATCTGCATTCATAACTTTGCTCGAGCAAAGTTATGAATGCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-452s21c1
Sequence:CCGGCCAAATTCAGCTACAAGATAGCTCGAGCTATCTTGTAGCTGAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-694s21c1
Sequence:CCGGATGGATCGCAACCGAATTAAACTCGAGTTTAATTCGGTTGCGATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-607s21c1
Sequence:CCGGGTGAATACTCAAGTACCATATCTCGAGATATGGTACTTGAGTATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-288s21c1
Sequence:CCGGTGACATGGACACGTCAGATACCTCGAGGTATCTGACGTGTCCATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1058s21c1
Sequence:CCGGTGCTAATTGGAGATTACATAACTCGAGTTATGTAATCTCCAATTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-505s21c1
Sequence:CCGGACTGGAAAGCAGCGCTTAATACTCGAGTATTAAGCGCTGCTTTCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1497s21c1
Sequence:CCGGATCAGCTGAGTCTCAACTAATCTCGAGATTAGTTGAGACTCAGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1614s21c1
Sequence:CCGGAGACATAAATGTGTCCCTTTACTCGAGTAAAGGGACACATTTATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-795s21c1
Sequence:CCGGGCCTCAGATTAATGAACAAATCTCGAGATTTGTTCATTAATCTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020367
VALIDATED
PARP11 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 11
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1046s1c1
Sequence:CCGGGACGGGAGCTATGTGAATTTACTCGAGTAAATTCACATAGCTCCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-569s1c1
Sequence:CCGGCCTCTGCACAATCAAACACATCTCGAGATGTGTTTGATTGTGCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1123s1c1
Sequence:CCGGCAACCAAATCTATCCTGAGTACTCGAGTACTCAGGATAGATTTGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020367.x-1020s1c1
Sequence:CCGGCCAAATACATGCGACCTCCTTCTCGAGAAGGAGGTCGCATGTATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020367.x-1176s1c1
Sequence:CCGGTCTCGGTGGTCAAGGAAGCTTCTCGAGAAGCTTCCTTGACCACCGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-665s21c1
Sequence:CCGGATGAAGTTGCTAATCTCTTTGCTCGAGCAAAGAGATTAGCAACTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1017s21c1
Sequence:CCGGGCATCTGTTTAGAACATATAACTCGAGTTATATGTTCTAAACAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-851s21c1
Sequence:CCGGCAATCTGCATTCATAACTTTGCTCGAGCAAAGTTATGAATGCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-452s21c1
Sequence:CCGGCCAAATTCAGCTACAAGATAGCTCGAGCTATCTTGTAGCTGAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-694s21c1
Sequence:CCGGATGGATCGCAACCGAATTAAACTCGAGTTTAATTCGGTTGCGATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-607s21c1
Sequence:CCGGGTGAATACTCAAGTACCATATCTCGAGATATGGTACTTGAGTATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-288s21c1
Sequence:CCGGTGACATGGACACGTCAGATACCTCGAGGTATCTGACGTGTCCATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-1058s21c1
Sequence:CCGGTGCTAATTGGAGATTACATAACTCGAGTTATGTAATCTCCAATTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-505s21c1
Sequence:CCGGACTGGAAAGCAGCGCTTAATACTCGAGTATTAAGCGCTGCTTTCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1497s21c1
Sequence:CCGGATCAGCTGAGTCTCAACTAATCTCGAGATTAGTTGAGACTCAGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020367.4-1614s21c1
Sequence:CCGGAGACATAAATGTGTCCCTTTACTCGAGTAAAGGGACACATTTATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020367.4-795s21c1
Sequence:CCGGGCCTCAGATTAATGAACAAATCTCGAGATTTGTTCATTAATCTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181402
VALIDATED
PARP11 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.2-455s1c1
Sequence:CCGGCAAGATAGACTTTGCAGAAATCTCGAGATTTCTGCAAAGTCTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181402.2-2553s1c1
Sequence:CCGGCCATTCATTCAGCTTTGTAAACTCGAGTTTACAAAGCTGAATGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-497s21c1
Sequence:CCGGTGGGAAACAGCGCCTAATAAACTCGAGTTTATTAGGCGCTGTTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-684s21c1
Sequence:CCGGATGGATCGGAACCGAATTAAACTCGAGTTTAATTCGGTTCCGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-1008s21c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181402.3-3343s21c1
Sequence:CCGGCGTAGAAGTCACTCGTGTTAACTCGAGTTAACACGAGTGACTTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.3-1008s1c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181402
VALIDATED
PARP11 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.2-455s1c1
Sequence:CCGGCAAGATAGACTTTGCAGAAATCTCGAGATTTCTGCAAAGTCTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181402.2-2553s1c1
Sequence:CCGGCCATTCATTCAGCTTTGTAAACTCGAGTTTACAAAGCTGAATGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-497s21c1
Sequence:CCGGTGGGAAACAGCGCCTAATAAACTCGAGTTTATTAGGCGCTGTTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-684s21c1
Sequence:CCGGATGGATCGGAACCGAATTAAACTCGAGTTTAATTCGGTTCCGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-1008s21c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181402.3-3343s21c1
Sequence:CCGGCGTAGAAGTCACTCGTGTTAACTCGAGTTAACACGAGTGACTTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.3-1008s1c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181402
VALIDATED
PARP11 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.2-455s1c1
Sequence:CCGGCAAGATAGACTTTGCAGAAATCTCGAGATTTCTGCAAAGTCTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181402.2-2553s1c1
Sequence:CCGGCCATTCATTCAGCTTTGTAAACTCGAGTTTACAAAGCTGAATGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-497s21c1
Sequence:CCGGTGGGAAACAGCGCCTAATAAACTCGAGTTTATTAGGCGCTGTTTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-684s21c1
Sequence:CCGGATGGATCGGAACCGAATTAAACTCGAGTTTAATTCGGTTCCGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181402.3-1008s21c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181402.3-3343s21c1
Sequence:CCGGCGTAGAAGTCACTCGTGTTAACTCGAGTTAACACGAGTGACTTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181402.3-1008s1c1
Sequence:CCGGCATCTGTTCAGAACCTATAAACTCGAGTTTATAGGTTCTGAACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)