EMAIL THIS PAGE TO A FRIEND

PARP14

poly (ADP-ribose) polymerase family, member 14

110 Gene Product Result for
Synonyms: ARTD8 BAL2 PARP-14 pART8
Gene ID:
Human(54625) Summary: Poly(ADP-ribosyl)ation is an immediate DNA damage-dependent posttranslational modification of histones and other nuclear proteins that contributes to the survival of injured proliferating cells. PARP14 belongs to the superfamily of enzymes that perform this modification (Ame et al., 2004 [PubMed 15273990]
Mouse(547253) poly (ADP-ribose) polymerase family, member 14
Rat(303903) poly (ADP-ribose) polymerase family, member 14
Zebrafish(562648) poly (ADP-ribose) polymerase family, member 14
dog(608688) poly (ADP-ribose) polymerase family, member 14
Horse(100070561) poly (ADP-ribose) polymerase family, member 14
cow(540789) poly (ADP-ribose) polymerase family, member 14
domestic cat(101091646) poly (ADP-ribose) polymerase family, member 14
chicken(424266) poly (ADP-ribose) polymerase family, member 14
domestic guinea pig(100716698) poly (ADP-ribose) polymerase family, member 14
naked mole-rat(101698647) poly (ADP-ribose) polymerase family, member 14
sheep(101114323) poly (ADP-ribose) polymerase family, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017554 Rosetta Predictions human pricing
XM_001071334 Rosetta Predictions rat pricing
XM_221401 Rosetta Predictions rat pricing
NM_001039530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350199 predicted 533
2 SASI_Hs01_00178227 predicted 2514
3 SASI_Hs01_00178228 predicted 1128
4 SASI_Hs01_00178229 predicted 4773
5 SASI_Hs01_00178231 predicted 3296
6 SASI_Hs01_00178232 predicted 1542
7 SASI_Hs01_00178233 predicted 1173
8 SASI_Hs01_00178234 predicted 3316
9 SASI_Hs02_00350200 predicted 3611
10 SASI_Hs01_00178236 predicted 5015
11 SASI_Hs01_00178230 predicted 4158
12 SASI_Hs01_00178235 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334709 predicted 3863
2 SASI_Rn02_00334710 predicted 5445
3 SASI_Rn02_00334711 predicted 2724
4 SASI_Rn02_00334712 predicted 2198
5 SASI_Rn02_00334713 predicted 4895
6 SASI_Rn02_00334714 predicted 2095
7 SASI_Rn02_00334715 predicted 1698
8 SASI_Rn02_00334716 predicted 3735
9 SASI_Rn02_00334717 predicted 1333
10 SASI_Rn02_00334718 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380092 predicted 3862
2 SASI_Rn02_00380093 predicted 5445
3 SASI_Rn02_00380094 predicted 2724
4 SASI_Rn02_00380095 predicted 2202
5 SASI_Rn02_00380096 predicted 4899
6 SASI_Rn02_00380097 predicted 2098
7 SASI_Rn02_00380098 predicted 1703
8 SASI_Rn02_00380099 predicted 3727
9 SASI_Rn02_00380100 predicted 1331
10 SASI_Rn02_00380101 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041264 predicted 5409
2 SASI_Mm01_00041267 predicted 2745
3 SASI_Mm01_00041268 predicted 3892
4 SASI_Mm01_00041269 predicted 643
5 SASI_Mm01_00041270 predicted 3028
6 SASI_Mm01_00041271 predicted 208
7 SASI_Mm01_00041272 predicted 3481
8 SASI_Mm02_00290119 predicted 2600
9 SASI_Mm02_00290120 predicted 1815
10 SASI_Mm01_00041273 predicted 4563
11 SASI_Mm01_00041265 predicted 5089
12 SASI_Mm01_00041266 predicted 5209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017554
VALIDATED
PARP14 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1328s21c1
Sequence:CCGGGATTGAGTTTGATACACTTAACTCGAGTTAAGTGTATCAAACTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-2731s21c1
Sequence:CCGGCGAGGTGTGTGTACCTATTAACTCGAGTTAATAGGTACACACACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-5431s21c1
Sequence:CCGGCATACCCAGAGTACCTTATTACTCGAGTAATAAGGTACTCTGGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017554.2-6094s21c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1017s21c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3268s1c1
Sequence:CCGGGCCATAATTGATGCCATTGAACTCGAGTTCAATGGCATCAATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-5267s1c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-190s1c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017554.1-1030s1c1
Sequence:CCGGCGCATTGAAGTTGAGAACAAACTCGAGTTTGTTCTCAACTTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3814s1c1
Sequence:CCGGGCAGATTGTATCAGTGAGTTTCTCGAGAAACTCACTGATACAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017554
VALIDATED
PARP14 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1328s21c1
Sequence:CCGGGATTGAGTTTGATACACTTAACTCGAGTTAAGTGTATCAAACTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-2731s21c1
Sequence:CCGGCGAGGTGTGTGTACCTATTAACTCGAGTTAATAGGTACACACACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-5431s21c1
Sequence:CCGGCATACCCAGAGTACCTTATTACTCGAGTAATAAGGTACTCTGGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017554.2-6094s21c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1017s21c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3268s1c1
Sequence:CCGGGCCATAATTGATGCCATTGAACTCGAGTTCAATGGCATCAATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-5267s1c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-190s1c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017554.1-1030s1c1
Sequence:CCGGCGCATTGAAGTTGAGAACAAACTCGAGTTTGTTCTCAACTTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3814s1c1
Sequence:CCGGGCAGATTGTATCAGTGAGTTTCTCGAGAAACTCACTGATACAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017554
VALIDATED
PARP14 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1328s21c1
Sequence:CCGGGATTGAGTTTGATACACTTAACTCGAGTTAAGTGTATCAAACTCAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-2731s21c1
Sequence:CCGGCGAGGTGTGTGTACCTATTAACTCGAGTTAATAGGTACACACACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017554.2-5431s21c1
Sequence:CCGGCATACCCAGAGTACCTTATTACTCGAGTAATAAGGTACTCTGGGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017554.2-6094s21c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017554.2-1017s21c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3268s1c1
Sequence:CCGGGCCATAATTGATGCCATTGAACTCGAGTTCAATGGCATCAATTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-5267s1c1
Sequence:CCGGCGGAACTTCATTCTTCACAAACTCGAGTTTGTGAAGAATGAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-190s1c1
Sequence:CCGGGCACCATTTGAAGAGTCACTACTCGAGTAGTGACTCTTCAAATGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017554.1-1030s1c1
Sequence:CCGGCGCATTGAAGTTGAGAACAAACTCGAGTTTGTTCTCAACTTCAATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017554.1-3814s1c1
Sequence:CCGGGCAGATTGTATCAGTGAGTTTCTCGAGAAACTCACTGATACAATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039530
VALIDATED
PARP14 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-1899s21c1
Sequence:CCGGAGCTCTTGTGCAACCATTATACTCGAGTATAATGGTTGCACAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5663s21c1
Sequence:CCGGACTTCGTTCACCTCGAATATGCTCGAGCATATTCGAGGTGAACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-2603s21c1
Sequence:GTACCGGAGAATGTGACCAGATAGTAAACTCGAGTTTACTATCTGGTCACATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5201s21c1
Sequence:CCGGCTACGGGAAAGGAACCTATTTCTCGAGAAATAGGTTCCTTTCCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039530.3-648s21c1
Sequence:CCGGTGTATCAGCCACCGCTCAAATCTCGAGATTTGAGCGGTGGCTGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039530
VALIDATED
PARP14 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-1899s21c1
Sequence:CCGGAGCTCTTGTGCAACCATTATACTCGAGTATAATGGTTGCACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5663s21c1
Sequence:CCGGACTTCGTTCACCTCGAATATGCTCGAGCATATTCGAGGTGAACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-2603s21c1
Sequence:GTACCGGAGAATGTGACCAGATAGTAAACTCGAGTTTACTATCTGGTCACATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5201s21c1
Sequence:CCGGCTACGGGAAAGGAACCTATTTCTCGAGAAATAGGTTCCTTTCCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039530.3-648s21c1
Sequence:CCGGTGTATCAGCCACCGCTCAAATCTCGAGATTTGAGCGGTGGCTGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039530
VALIDATED
PARP14 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-1899s21c1
Sequence:CCGGAGCTCTTGTGCAACCATTATACTCGAGTATAATGGTTGCACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5663s21c1
Sequence:CCGGACTTCGTTCACCTCGAATATGCTCGAGCATATTCGAGGTGAACGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-2603s21c1
Sequence:GTACCGGAGAATGTGACCAGATAGTAAACTCGAGTTTACTATCTGGTCACATTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039530.3-5201s21c1
Sequence:CCGGCTACGGGAAAGGAACCTATTTCTCGAGAAATAGGTTCCTTTCCCGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039530.3-648s21c1
Sequence:CCGGTGTATCAGCCACCGCTCAAATCTCGAGATTTGAGCGGTGGCTGATACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)