EMAIL THIS PAGE TO A FRIEND

PARP15

poly (ADP-ribose) polymerase family, member 15

42 Gene Product Result for
Synonyms: ARTD7 BAL3 pART7
UniProtKB ID: Q460N3, Q8N1K3
Gene ID:
Human(165631) Summary: PARP15 is a macrodomain-containing transcriptional repressor with poly(ADP-ribose) polymerase activity (Aguiar et al., 2005 [PubMed 16061477]
Horse(100070587) poly (ADP-ribose) polymerase family, member 15
domestic cat(101091391) poly (ADP-ribose) polymerase family, member 15
dog(608662) poly (ADP-ribose) polymerase family, member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005101 MISSION® esiRNA esiRNA targeting human PARP15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113523 Rosetta Predictions human pricing
NM_152615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325991 predicted 1025
2 SASI_Hs02_00325992 predicted 1604
3 SASI_Hs02_00325993 predicted 1986
4 SASI_Hs02_00325994 predicted 1710
5 SASI_Hs02_00325995 predicted 1310
6 SASI_Hs02_00325996 predicted 1223
7 SASI_Hs02_00325997 predicted 2154
8 SASI_Hs02_00325998 predicted 1636
9 SASI_Hs02_00325999 predicted 1591
10 SASI_Hs02_00326000 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366468 predicted 874
2 SASI_Hs02_00366469 predicted 873
3 SASI_Hs01_00237037 predicted 1250
4 SASI_Hs01_00237038 predicted 967
5 SASI_Hs01_00237039 predicted 576
6 SASI_Hs01_00237040 predicted 487
7 SASI_Hs01_00237041 predicted 1409
8 SASI_Hs01_00237042 predicted 902
9 SASI_Hs01_00237043 predicted 861
10 SASI_Hs01_00237044 predicted 1250
11 SASI_Hs01_00237036 predicted 297
12 SASI_Hs01_00237045 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152615
PARP15 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-674s21c1
Sequence:CCGGTCAACCTGAGCTGCTAAATATCTCGAGATATTTAGCAGCTCAGGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1175s21c1
Sequence:CCGGGTACGTTGTGCGAGTACTTACCTCGAGGTAAGTACTCGCACAACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1105s21c1
Sequence:CCGGTTGCTGTGGATGCCAGTTATTCTCGAGAATAACTGGCATCCACAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1337s1c1
Sequence:CCGGCCCAGAATATCTCATAACTTTCTCGAGAAAGTTATGAGATATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-830s1c1
Sequence:CCGGGCCAGGACAATCAGAATATAACTCGAGTTATATTCTGATTGTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-722s1c1
Sequence:CCGGCCTCTCTGCATCACTGAACTTCTCGAGAAGTTCAGTGATGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1236s1c1
Sequence:CCGGCCACCCAAGAATCCTCACAATCTCGAGATTGTGAGGATTCTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-270s1c1
Sequence:CCGGGCCACTGAACAGGTAGATGTTCTCGAGAACATCTACCTGTTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152615
PARP15 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-674s21c1
Sequence:CCGGTCAACCTGAGCTGCTAAATATCTCGAGATATTTAGCAGCTCAGGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1175s21c1
Sequence:CCGGGTACGTTGTGCGAGTACTTACCTCGAGGTAAGTACTCGCACAACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1105s21c1
Sequence:CCGGTTGCTGTGGATGCCAGTTATTCTCGAGAATAACTGGCATCCACAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1337s1c1
Sequence:CCGGCCCAGAATATCTCATAACTTTCTCGAGAAAGTTATGAGATATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-830s1c1
Sequence:CCGGGCCAGGACAATCAGAATATAACTCGAGTTATATTCTGATTGTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-722s1c1
Sequence:CCGGCCTCTCTGCATCACTGAACTTCTCGAGAAGTTCAGTGATGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1236s1c1
Sequence:CCGGCCACCCAAGAATCCTCACAATCTCGAGATTGTGAGGATTCTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-270s1c1
Sequence:CCGGGCCACTGAACAGGTAGATGTTCTCGAGAACATCTACCTGTTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152615
PARP15 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-674s21c1
Sequence:CCGGTCAACCTGAGCTGCTAAATATCTCGAGATATTTAGCAGCTCAGGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1175s21c1
Sequence:CCGGGTACGTTGTGCGAGTACTTACCTCGAGGTAAGTACTCGCACAACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152615.1-1105s21c1
Sequence:CCGGTTGCTGTGGATGCCAGTTATTCTCGAGAATAACTGGCATCCACAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1337s1c1
Sequence:CCGGCCCAGAATATCTCATAACTTTCTCGAGAAAGTTATGAGATATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-830s1c1
Sequence:CCGGGCCAGGACAATCAGAATATAACTCGAGTTATATTCTGATTGTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-722s1c1
Sequence:CCGGCCTCTCTGCATCACTGAACTTCTCGAGAAGTTCAGTGATGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-1236s1c1
Sequence:CCGGCCACCCAAGAATCCTCACAATCTCGAGATTGTGAGGATTCTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152615.1-270s1c1
Sequence:CCGGGCCACTGAACAGGTAGATGTTCTCGAGAACATCTACCTGTTCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)