EMAIL THIS PAGE TO A FRIEND

PARP1

poly (ADP-ribose) polymerase 1

89 Gene Product Result for
Synonyms: ADPRT ADPRT 1 ADPRT1 ARTD1 PARP PARP-1 PPOL pADPRT-1
UniProtKB ID: P09874, B1ANJ4, Q8IUZ9
Gene ID:
Human(142) Summary: This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
Mouse(11545) poly (ADP-ribose) polymerase family, member 1
Rat(25591) poly (ADP-ribose) polymerase 1
Thale Cress(817690) poly [ADP-ribose] polymerase 2
Zebrafish(560788) poly (ADP-ribose) polymerase family, member 1
chicken(396199) poly (ADP-ribose) polymerase 1
dog(490385) poly (ADP-ribose) polymerase 1
domestic cat(101081434) poly (ADP-ribose) polymerase 1
Horse(100058523) poly (ADP-ribose) polymerase 1
cow(286764) poly (ADP-ribose) polymerase 1
domestic guinea pig(100733925) poly (ADP-ribose) polymerase 1
naked mole-rat(101703207) poly (ADP-ribose) polymerase 1
sheep(100135697) poly (ADP-ribose) polymerase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500487 Anti-PARP (Cleaved-Asp214) antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4500488 Anti-PARP (Cleaved-Gly215) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
P7605 Anti-PARP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
SAB5700016 Anti-PARP1 antibody produced in rabbit New mouse, rat, human
ChIP, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA045168 Anti-PARP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AV33754 Anti-PARP1 antibody produced in rabbit IgG fraction of antiserum bovine, horse, mouse, human, dog, rabbit, rat, guinea pig
western blot pricing
P248 Monoclonal Anti-PARP antibody produced in mouse clone C-2-10, ascites fluid primate, mouse, hamster, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
WH0000142M1 Monoclonal Anti-PARP1 antibody produced in mouse clone 3G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403527 Monoclonal Anti-PARP1, (N-terminal) antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0184 Rabbit anti-PARP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1626 Human PARP1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001618 Rosetta Predictions human pricing
NM_013063 Rosetta Predictions rat pricing
NM_007415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332177 predicted 1998
2 SASI_Hs01_00159524 predicted 616
3 SASI_Hs01_00159525 predicted 2675
4 SASI_Hs01_00159526 predicted 2707
5 SASI_Hs01_00159527 predicted 1318
6 SASI_Hs01_00159528 predicted 1578
7 SASI_Hs01_00159531 predicted 2650
8 SASI_Hs01_00159529 predicted 2562
9 SASI_Hs01_00159530 predicted 2911
10 SASI_Hs01_00159532 predicted 2712
11 SASI_Hs01_00159523 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061002 predicted 1754
2 SASI_Rn01_00061003 predicted 1837
3 SASI_Rn01_00061004 predicted 1759
4 SASI_Rn01_00061005 predicted 1878
5 SASI_Rn01_00061006 predicted 2541
6 SASI_Rn01_00061007 predicted 3065
7 SASI_Rn01_00061009 predicted 2456
8 SASI_Rn01_00061010 predicted 509
9 SASI_Rn01_00061011 predicted 3036
10 SASI_Rn02_00260803 predicted 1959
11 SASI_Rn01_00061008 predicted 2559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129786 predicted 505
2 SASI_Mm01_00129787 predicted 1089
3 SASI_Mm02_00311559 predicted 1649
4 SASI_Mm01_00129788 predicted 2449
5 SASI_Mm01_00129789 predicted 1626
6 SASI_Mm01_00129790 predicted 1833
7 SASI_Mm01_00129792 predicted 964
8 SASI_Mm01_00129793 predicted 1262
9 SASI_Mm02_00311560 predicted 1580
10 SASI_Mm01_00129794 predicted 2539
11 SASI_Mm01_00129791 predicted 2550
12 SASI_Mm01_00129795 predicted 2237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001618
VALIDATED
PARP1 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3619s21c1
Sequence:CCGGTGGAAAGATGTTAAGCATTTACTCGAGTAAATGCTTAACATCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2727s21c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2908s21c1
Sequence:CCGGGGAGACCCAATAGGCTTAATCCTCGAGGATTAAGCCTATTGGGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2842s21c1
Sequence:CCGGTTTGGTAAAGGGATCTATTTCCTCGAGGAAATAGATCCCTTTACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-897s21c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-3516s1c1
Sequence:CCGGCTTCGTTAGAATGTCTGCCTTCTCGAGAAGGCAGACATTCTAACGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-2715s1c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-1176s1c1
Sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-885s1c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-3038s21c1
Sequence:CCGGCTGATCCTTCAGCTAACATTACTCGAGTAATGTTAGCTGAAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3589s21c1
Sequence:CCGGTTTCTAAGTGTTCGTCTTTAGCTCGAGCTAAAGACGAACACTTAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001618.2-2962s1c1
Sequence:CCGGGCTTCACATATCAGCAGGTTACTCGAGTAACCTGCTGATATGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001618
VALIDATED
PARP1 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3619s21c1
Sequence:CCGGTGGAAAGATGTTAAGCATTTACTCGAGTAAATGCTTAACATCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2727s21c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2908s21c1
Sequence:CCGGGGAGACCCAATAGGCTTAATCCTCGAGGATTAAGCCTATTGGGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2842s21c1
Sequence:CCGGTTTGGTAAAGGGATCTATTTCCTCGAGGAAATAGATCCCTTTACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-897s21c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-3516s1c1
Sequence:CCGGCTTCGTTAGAATGTCTGCCTTCTCGAGAAGGCAGACATTCTAACGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-2715s1c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-1176s1c1
Sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-885s1c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-3038s21c1
Sequence:CCGGCTGATCCTTCAGCTAACATTACTCGAGTAATGTTAGCTGAAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3589s21c1
Sequence:CCGGTTTCTAAGTGTTCGTCTTTAGCTCGAGCTAAAGACGAACACTTAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001618.2-2962s1c1
Sequence:CCGGGCTTCACATATCAGCAGGTTACTCGAGTAACCTGCTGATATGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001618
VALIDATED
PARP1 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3619s21c1
Sequence:CCGGTGGAAAGATGTTAAGCATTTACTCGAGTAAATGCTTAACATCTTTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2727s21c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2908s21c1
Sequence:CCGGGGAGACCCAATAGGCTTAATCCTCGAGGATTAAGCCTATTGGGTCTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000350913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-2842s21c1
Sequence:CCGGTTTGGTAAAGGGATCTATTTCCTCGAGGAAATAGATCCCTTTACCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-897s21c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-3516s1c1
Sequence:CCGGCTTCGTTAGAATGTCTGCCTTCTCGAGAAGGCAGACATTCTAACGAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-2715s1c1
Sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-1176s1c1
Sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001618.2-885s1c1
Sequence:CCGGCGACCTGATCTGGAACATCAACTCGAGTTGATGTTCCAGATCAGGTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001618.3-3038s21c1
Sequence:CCGGCTGATCCTTCAGCTAACATTACTCGAGTAATGTTAGCTGAAGGATCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001618.3-3589s21c1
Sequence:CCGGTTTCTAAGTGTTCGTCTTTAGCTCGAGCTAAAGACGAACACTTAGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001618.2-2962s1c1
Sequence:CCGGGCTTCACATATCAGCAGGTTACTCGAGTAACCTGCTGATATGTGAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007415
VALIDATED
PARP1 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-121s21c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3498s21c1
Sequence:CCGGGGTTCATCTTTGCTTTAATTTCTCGAGAAATTAAAGCAAAGATGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2428s21c1
Sequence:CCGGTCGACGTCAACTACGAGAAACCTCGAGGTTTCTCGTAGTTGACGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3021s21c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2832s21c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007415.2-3605s1c1
Sequence:CCGGCCTCTTAGTCTGCTGAGCTTTCTCGAGAAAGCTCAGCAGACTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-3021s1c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-2832s1c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-658s1c1
Sequence:CCGGCGGCCATCAAGAATGAAGGAACTCGAGTTCCTTCATTCTTGATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-121s1c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007415
VALIDATED
PARP1 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-121s21c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3498s21c1
Sequence:CCGGGGTTCATCTTTGCTTTAATTTCTCGAGAAATTAAAGCAAAGATGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2428s21c1
Sequence:CCGGTCGACGTCAACTACGAGAAACCTCGAGGTTTCTCGTAGTTGACGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3021s21c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2832s21c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007415.2-3605s1c1
Sequence:CCGGCCTCTTAGTCTGCTGAGCTTTCTCGAGAAAGCTCAGCAGACTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-3021s1c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-2832s1c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-658s1c1
Sequence:CCGGCGGCCATCAAGAATGAAGGAACTCGAGTTCCTTCATTCTTGATGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-121s1c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007415
VALIDATED
PARP1 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-121s21c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3498s21c1
Sequence:CCGGGGTTCATCTTTGCTTTAATTTCTCGAGAAATTAAAGCAAAGATGAACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2428s21c1
Sequence:CCGGTCGACGTCAACTACGAGAAACCTCGAGGTTTCTCGTAGTTGACGTCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-3021s21c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007415.2-2832s21c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007415.2-3605s1c1
Sequence:CCGGCCTCTTAGTCTGCTGAGCTTTCTCGAGAAAGCTCAGCAGACTAAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-3021s1c1
Sequence:CCGGGAGTACATTGTCTACGACATTCTCGAGAATGTCGTAGACAATGTACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-2832s1c1
Sequence:CCGGGCCCTTGGAAACATGTATGAACTCGAGTTCATACATGTTTCCAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-658s1c1
Sequence:CCGGCGGCCATCAAGAATGAAGGAACTCGAGTTCCTTCATTCTTGATGGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007415.2-121s1c1
Sequence:CCGGGCAAGAAATGCAGCGAGAGTACTCGAGTACTCTCGCTGCATTTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???