EMAIL THIS PAGE TO A FRIEND

PARP3

poly (ADP-ribose) polymerase family, member 3

77 Gene Product Result for
Synonyms: ADPRT3 ADPRTL2 ADPRTL3 ARTD3 IRT1 PADPRT-3
UniProtKB ID: Q9Y6F1, Q8NER9, Q96CG2, Q9UG81
Gene ID:
Human(10039) Summary: The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(235587) poly (ADP-ribose) polymerase family, member 3
Rat(300985) poly (ADP-ribose) polymerase family, member 3
sheep(101115070) poly (ADP-ribose) polymerase family, member 3
domestic guinea pig(100721827) poly (ADP-ribose) polymerase family, member 3
naked mole-rat(101725931) poly (ADP-ribose) polymerase family, member 3
Domestic Rabbit(100344824) poly (ADP-ribose) polymerase family, member 3
Zebrafish(335495) poly (ADP-ribose) polymerase family, member 3
cow(507426) poly (ADP-ribose) polymerase family, member 3
Horse(100060729) poly (ADP-ribose) polymerase family, member 3
domestic cat(101100038) poly (ADP-ribose) polymerase family, member 3
dog(484745) poly (ADP-ribose) polymerase family, member 3
chicken(771158) poly (ADP-ribose) polymerase family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003931 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003931 Rosetta Predictions human pricing
NM_001003935 Rosetta Predictions human pricing
NM_005485 Rosetta Predictions human pricing
NM_001008328 Rosetta Predictions rat pricing
NM_145619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207763 predicted 677
2 SASI_Hs01_00207764 predicted 1623
3 SASI_Hs01_00207765 predicted 1425
4 SASI_Hs01_00207766 predicted 873
5 SASI_Hs01_00207767 predicted 1594
6 SASI_Hs01_00207768 predicted 566
7 SASI_Hs01_00207769 predicted 1379
8 SASI_Hs01_00207770 predicted 1137
9 SASI_Hs01_00207771 predicted 699
10 SASI_Hs01_00207772 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058401 predicted 797
2 SASI_Hs01_00058402 predicted 1737
3 SASI_Hs01_00058403 predicted 1547
4 SASI_Hs01_00058404 predicted 1001
5 SASI_Hs01_00058405 predicted 1719
6 SASI_Hs01_00058406 predicted 692
7 SASI_Hs01_00058407 predicted 1496
8 SASI_Hs01_00058408 predicted 1257
9 SASI_Hs01_00058409 predicted 820
10 SASI_Hs01_00058410 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097034 predicted 681
2 SASI_Hs01_00097035 predicted 1626
3 SASI_Hs01_00097036 predicted 1427
4 SASI_Hs01_00097037 predicted 882
5 SASI_Hs01_00097038 predicted 1605
6 SASI_Hs01_00097039 predicted 568
7 SASI_Hs01_00097040 predicted 1383
8 SASI_Hs01_00097041 predicted 1142
9 SASI_Hs01_00097042 predicted 703
10 SASI_Hs01_00097043 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052938 predicted 676
2 SASI_Rn01_00052939 predicted 289
3 SASI_Rn01_00052940 predicted 547
4 SASI_Rn01_00052941 predicted 1300
5 SASI_Rn01_00052942 predicted 1293
6 SASI_Rn02_00199070 predicted 716
7 SASI_Rn02_00199071 predicted 528
8 SASI_Rn01_00052944 predicted 335
9 SASI_Rn01_00052945 predicted 1365
10 SASI_Rn01_00052946 predicted 708
11 SASI_Rn01_00052943 predicted 330
12 SASI_Rn01_00052947 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170377 predicted 2192
2 SASI_Mm01_00170378 predicted 769
3 SASI_Mm01_00170379 predicted 587
4 SASI_Mm01_00170380 predicted 1406
5 SASI_Mm01_00170381 predicted 329
6 SASI_Mm01_00170382 predicted 1682
7 SASI_Mm01_00170384 predicted 396
8 SASI_Mm01_00170385 predicted 1739
9 SASI_Mm02_00341193 predicted 844
10 SASI_Mm02_00341194 predicted 1419
11 SASI_Mm01_00170376 predicted 979
12 SASI_Mm01_00170383 predicted 2228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003931
VALIDATED
PARP3 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-2109s1c1
Sequence:CCGGCCCTGAACTTATGCCTCCTAACTCGAGTTAGGAGGCATAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1710s1c1
Sequence:CCGGGCACCATATCAACACGGACAACTCGAGTTGTCCGTGTTGATATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-687s1c1
Sequence:CCGGCCAGTCAAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-576s1c1
Sequence:CCGGCCAGACCAACATCGAGAACAACTCGAGTTGTTCTCGATGTTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1360s1c1
Sequence:CCGGGCACCTGAGTACAAGGTGATACTCGAGTATCACCTTGTACTCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-483s21c1
Sequence:CCGGACCCGCAGAGAAGCGCATAATCTCGAGATTATGCGCTTCTCTGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-1481s21c1
Sequence:CCGGCCCACTCCAAACTGGGTAATCCTCGAGGATTACCCAGTTTGGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-2103s21c1
Sequence:CCGGGTACAAGATCCCTGAACTTATCTCGAGATAAGTTCAGGGATCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1626s21c1
Sequence:GTACCGGCAAGTCAGCTGGATATGTTATCTCGAGATAACATATCCAGCTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1376s21c1
Sequence:CCGGAGGTGATACAGACCTACTTAGCTCGAGCTAAGTAGGTCTGTATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003931
VALIDATED
PARP3 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-2109s1c1
Sequence:CCGGCCCTGAACTTATGCCTCCTAACTCGAGTTAGGAGGCATAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1710s1c1
Sequence:CCGGGCACCATATCAACACGGACAACTCGAGTTGTCCGTGTTGATATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-687s1c1
Sequence:CCGGCCAGTCAAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-576s1c1
Sequence:CCGGCCAGACCAACATCGAGAACAACTCGAGTTGTTCTCGATGTTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1360s1c1
Sequence:CCGGGCACCTGAGTACAAGGTGATACTCGAGTATCACCTTGTACTCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-483s21c1
Sequence:CCGGACCCGCAGAGAAGCGCATAATCTCGAGATTATGCGCTTCTCTGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-1481s21c1
Sequence:CCGGCCCACTCCAAACTGGGTAATCCTCGAGGATTACCCAGTTTGGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-2103s21c1
Sequence:CCGGGTACAAGATCCCTGAACTTATCTCGAGATAAGTTCAGGGATCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1626s21c1
Sequence:GTACCGGCAAGTCAGCTGGATATGTTATCTCGAGATAACATATCCAGCTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1376s21c1
Sequence:CCGGAGGTGATACAGACCTACTTAGCTCGAGCTAAGTAGGTCTGTATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003931
VALIDATED
PARP3 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-2109s1c1
Sequence:CCGGCCCTGAACTTATGCCTCCTAACTCGAGTTAGGAGGCATAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1710s1c1
Sequence:CCGGGCACCATATCAACACGGACAACTCGAGTTGTCCGTGTTGATATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-687s1c1
Sequence:CCGGCCAGTCAAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-576s1c1
Sequence:CCGGCCAGACCAACATCGAGAACAACTCGAGTTGTTCTCGATGTTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001003931.1-1360s1c1
Sequence:CCGGGCACCTGAGTACAAGGTGATACTCGAGTATCACCTTGTACTCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-483s21c1
Sequence:CCGGACCCGCAGAGAAGCGCATAATCTCGAGATTATGCGCTTCTCTGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-1481s21c1
Sequence:CCGGCCCACTCCAAACTGGGTAATCCTCGAGGATTACCCAGTTTGGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003931.2-2103s21c1
Sequence:CCGGGTACAAGATCCCTGAACTTATCTCGAGATAAGTTCAGGGATCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1626s21c1
Sequence:GTACCGGCAAGTCAGCTGGATATGTTATCTCGAGATAACATATCCAGCTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003931.2-1376s21c1
Sequence:CCGGAGGTGATACAGACCTACTTAGCTCGAGCTAAGTAGGTCTGTATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145619
VALIDATED
PARP3 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145619.2-2017s1c1
Sequence:CCGGGCCATGATTCACTCCTATAATCTCGAGATTATAGGAGTGAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-715s1c1
Sequence:CCGGCCAGAACCTTATCACCAACATCTCGAGATGTTGGTGATAAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-1684s1c1
Sequence:CCGGCCAGAGTGAATACCTCATATACTCGAGTATATGAGGTATTCACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-481s1c1
Sequence:CCGGCCAGAGCAAGATGAACCACTTCTCGAGAAGTGGTTCATCTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-595s1c1
Sequence:CCGGGCCCAACAAGTACACACTTATCTCGAGATAAGTGTGTACTTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145619
VALIDATED
PARP3 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145619.2-2017s1c1
Sequence:CCGGGCCATGATTCACTCCTATAATCTCGAGATTATAGGAGTGAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-715s1c1
Sequence:CCGGCCAGAACCTTATCACCAACATCTCGAGATGTTGGTGATAAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-1684s1c1
Sequence:CCGGCCAGAGTGAATACCTCATATACTCGAGTATATGAGGTATTCACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-481s1c1
Sequence:CCGGCCAGAGCAAGATGAACCACTTCTCGAGAAGTGGTTCATCTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-595s1c1
Sequence:CCGGGCCCAACAAGTACACACTTATCTCGAGATAAGTGTGTACTTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145619
VALIDATED
PARP3 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145619.2-2017s1c1
Sequence:CCGGGCCATGATTCACTCCTATAATCTCGAGATTATAGGAGTGAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-715s1c1
Sequence:CCGGCCAGAACCTTATCACCAACATCTCGAGATGTTGGTGATAAGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-1684s1c1
Sequence:CCGGCCAGAGTGAATACCTCATATACTCGAGTATATGAGGTATTCACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145619.2-481s1c1
Sequence:CCGGCCAGAGCAAGATGAACCACTTCTCGAGAAGTGGTTCATCTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145619.2-595s1c1
Sequence:CCGGGCCCAACAAGTACACACTTATCTCGAGATAAGTGTGTACTTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)