EMAIL THIS PAGE TO A FRIEND

PARP6

poly (ADP-ribose) polymerase family, member 6

112 Gene Product Result for
Synonyms: ARTD17 PARP-6-B1 PARP-6-C pART17
UniProtKB ID: Q2NL67, Q9H7C5, Q9H9X6, Q9HAF3, Q9NPS6, Q9UFG4
Gene ID:
Mouse(67287) poly (ADP-ribose) polymerase family, member 6
Rat(300759) poly (ADP-ribose) polymerase family, member 6
chicken(769472) poly (ADP-ribose) polymerase family, member 6
cow(511329) poly (ADP-ribose) polymerase family, member 6
domestic cat(101092272) poly (ADP-ribose) polymerase family, member 6
dog(478358) poly (ADP-ribose) polymerase family, member 6
sheep(101110145) poly (ADP-ribose) polymerase family, member 6
domestic guinea pig(100712682) poly (ADP-ribose) polymerase family, member 6
naked mole-rat(101719766) poly (ADP-ribose) polymerase family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34087 Anti-PARP6 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, guinea pig, canine, rat, horse
immunohistochemistry, western blot pricing
AV33766 Anti-PARP6 antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, horse, rat, bovine, zebrafish, mouse, human, rabbit
western blot pricing
HPA026991 Anti-PARP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133561 MISSION® esiRNA esiRNA human PARP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020214 Rosetta Predictions human pricing
NM_001106828 Rosetta Predictions rat pricing
NM_029922 Rosetta Predictions mouse pricing
XM_888089 Rosetta Predictions mouse pricing
XM_897776 Rosetta Predictions mouse pricing
XM_897784 Rosetta Predictions mouse pricing
XM_897794 Rosetta Predictions mouse pricing
XM_897842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353150 predicted 1205
2 SASI_Hs01_00036196 predicted 818
3 SASI_Hs01_00036198 predicted 656
4 SASI_Hs01_00036199 predicted 1633
5 SASI_Hs01_00036200 predicted 2150
6 SASI_Hs01_00036201 predicted 602
7 SASI_Hs01_00036202 predicted 574
8 SASI_Hs01_00036203 predicted 1879
9 SASI_Hs01_00036204 predicted 2384
10 SASI_Hs01_00036205 predicted 1867
11 SASI_Hs01_00036197 predicted 2332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222808 predicted 533
2 SASI_Rn02_00222809 predicted 1095
3 SASI_Rn02_00222810 predicted 498
4 SASI_Rn02_00222811 predicted 598
5 SASI_Rn02_00222812 predicted 1653
6 SASI_Rn02_00222813 predicted 714
7 SASI_Rn02_00222814 predicted 2175
8 SASI_Rn02_00222815 predicted 2153
9 SASI_Rn02_00222816 predicted 2347
10 SASI_Rn02_00222817 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336176 predicted 1173
2 SASI_Mm02_00336177 predicted 580
3 SASI_Mm02_00336178 predicted 2367
4 SASI_Mm02_00336179 predicted 1958
5 SASI_Mm02_00336180 predicted 2166
6 SASI_Mm02_00336181 predicted 2148
7 SASI_Mm02_00336182 predicted 669
8 SASI_Mm02_00336183 predicted 1382
9 SASI_Mm02_00336184 predicted 1921
10 SASI_Mm02_00336185 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263107 predicted 2332
2 SASI_Mm01_00263108 predicted 2493
3 SASI_Mm01_00263109 predicted 2373
4 SASI_Mm01_00263110 predicted 2331
5 SASI_Mm01_00263111 predicted 2331
6 SASI_Mm01_00263112 predicted 2339
7 SASI_Mm01_00263113 predicted 2376
8 SASI_Mm01_00263114 predicted 2375
9 SASI_Mm01_00263115 predicted 2370
10 SASI_Mm01_00263116 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245162 predicted 310
2 SASI_Mm01_00245163 predicted 240
3 SASI_Mm01_00245164 predicted 232
4 SASI_Mm01_00245165 predicted 254
5 SASI_Mm01_00245166 predicted 285
6 SASI_Mm01_00245167 predicted 313
7 SASI_Mm01_00245168 predicted 235
8 SASI_Mm01_00245169 predicted 276
9 SASI_Mm01_00245170 predicted 268
10 SASI_Mm01_00245171 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231952 predicted 641
2 SASI_Mm01_00231953 predicted 577
3 SASI_Mm01_00231954 predicted 568
4 SASI_Mm01_00231955 predicted 725
5 SASI_Mm01_00231956 predicted 586
6 SASI_Mm01_00231957 predicted 598
7 SASI_Mm01_00231958 predicted 673
8 SASI_Mm01_00231959 predicted 651
9 SASI_Mm01_00231960 predicted 566
10 SASI_Mm01_00231961 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274948 predicted 598
2 SASI_Mm01_00274949 predicted 585
3 SASI_Mm01_00274950 predicted 818
4 SASI_Mm01_00274951 predicted 1052
5 SASI_Mm01_00274952 predicted 811
6 SASI_Mm01_00274953 predicted 606
7 SASI_Mm01_00274954 predicted 673
8 SASI_Mm01_00274955 predicted 796
9 SASI_Mm01_00274956 predicted 645
10 SASI_Mm01_00274957 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212980 predicted 846
2 SASI_Mm01_00212981 predicted 996
3 SASI_Mm01_00212982 predicted 882
4 SASI_Mm01_00212983 predicted 852
5 SASI_Mm01_00212984 predicted 848
6 SASI_Mm01_00212985 predicted 848
7 SASI_Mm01_00212986 predicted 887
8 SASI_Mm01_00212987 predicted 878
9 SASI_Mm01_00212988 predicted 886
10 SASI_Mm01_00212989 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020213
VALIDATED
PARP6 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1187s1c1
Sequence:CCGGCCCTAGAAAGAGCATCATCTTCTCGAGAAGATGATGCTCTTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1053s1c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-761s1c1
Sequence:CCGGCCCTATCATACAGGACTCCATCTCGAGATGGAGTCCTGTATGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-944s1c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020213.1-1297s1c1
Sequence:CCGGCTCTGGATAGTGTGATGTCTACTCGAGTAGACATCACACTATCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020213
VALIDATED
PARP6 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1187s1c1
Sequence:CCGGCCCTAGAAAGAGCATCATCTTCTCGAGAAGATGATGCTCTTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1053s1c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-761s1c1
Sequence:CCGGCCCTATCATACAGGACTCCATCTCGAGATGGAGTCCTGTATGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-944s1c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020213.1-1297s1c1
Sequence:CCGGCTCTGGATAGTGTGATGTCTACTCGAGTAGACATCACACTATCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020213
VALIDATED
PARP6 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1187s1c1
Sequence:CCGGCCCTAGAAAGAGCATCATCTTCTCGAGAAGATGATGCTCTTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-1053s1c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-761s1c1
Sequence:CCGGCCCTATCATACAGGACTCCATCTCGAGATGGAGTCCTGTATGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020213.1-944s1c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020213.1-1297s1c1
Sequence:CCGGCTCTGGATAGTGTGATGTCTACTCGAGTAGACATCACACTATCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020214
VALIDATED
PARP6 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1641s21c1
Sequence:CCGGGATGACCCAGGGCTCATATTTCTCGAGAAATATGAGCCCTGGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-2389s21c1
Sequence:CCGGGGATCCATCTGCCCTCATAAACTCGAGTTTATGAGGGCAGATGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-491s21c1
Sequence:CCGGACGACTCGGAGGGAGATAATGCTCGAGCATTATCTCCCTCCGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1260s21c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1369s21c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020214
VALIDATED
PARP6 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1641s21c1
Sequence:CCGGGATGACCCAGGGCTCATATTTCTCGAGAAATATGAGCCCTGGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-2389s21c1
Sequence:CCGGGGATCCATCTGCCCTCATAAACTCGAGTTTATGAGGGCAGATGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-491s21c1
Sequence:CCGGACGACTCGGAGGGAGATAATGCTCGAGCATTATCTCCCTCCGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1260s21c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1369s21c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020214
VALIDATED
PARP6 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1641s21c1
Sequence:CCGGGATGACCCAGGGCTCATATTTCTCGAGAAATATGAGCCCTGGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-2389s21c1
Sequence:CCGGGGATCCATCTGCCCTCATAAACTCGAGTTTATGAGGGCAGATGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-491s21c1
Sequence:CCGGACGACTCGGAGGGAGATAATGCTCGAGCATTATCTCCCTCCGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1260s21c1
Sequence:CCGGCCTCGTTCAGATCATGAAGTACTCGAGTACTTCATGATCTGAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020214.2-1369s21c1
Sequence:CCGGGCTGTCTGTACTCGTGAACTACTCGAGTAGTTCACGAGTACAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029922
PARP6 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1177s21c1
Sequence:CCGGGCCTTATGAATCGTTCCATTTCTCGAGAAATGGAACGATTCATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-983s21c1
Sequence:CCGGGAAGCATCTGAGCAATGATTTCTCGAGAAATCATTGCTCAGATGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1326s21c1
Sequence:CCGGCAGAGGATTCCAACGTTAAATCTCGAGATTTAACGTTGGAATCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-2162s21c1
Sequence:CCGGCCTGCAGAGTCGGAATCTAAACTCGAGTTTAGATTCCGACTCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029922.2-2426s21c1
Sequence:CCGGGGATCCATCTGCCCTTGTAAACTCGAGTTTACAAGGGCAGATGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029922
PARP6 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1177s21c1
Sequence:CCGGGCCTTATGAATCGTTCCATTTCTCGAGAAATGGAACGATTCATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-983s21c1
Sequence:CCGGGAAGCATCTGAGCAATGATTTCTCGAGAAATCATTGCTCAGATGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1326s21c1
Sequence:CCGGCAGAGGATTCCAACGTTAAATCTCGAGATTTAACGTTGGAATCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-2162s21c1
Sequence:CCGGCCTGCAGAGTCGGAATCTAAACTCGAGTTTAGATTCCGACTCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029922.2-2426s21c1
Sequence:CCGGGGATCCATCTGCCCTTGTAAACTCGAGTTTACAAGGGCAGATGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029922
PARP6 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1177s21c1
Sequence:CCGGGCCTTATGAATCGTTCCATTTCTCGAGAAATGGAACGATTCATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-983s21c1
Sequence:CCGGGAAGCATCTGAGCAATGATTTCTCGAGAAATCATTGCTCAGATGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-1326s21c1
Sequence:CCGGCAGAGGATTCCAACGTTAAATCTCGAGATTTAACGTTGGAATCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029922.2-2162s21c1
Sequence:CCGGCCTGCAGAGTCGGAATCTAAACTCGAGTTTAGATTCCGACTCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029922.2-2426s21c1
Sequence:CCGGGGATCCATCTGCCCTTGTAAACTCGAGTTTACAAGGGCAGATGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)