EMAIL THIS PAGE TO A FRIEND

PARP8

poly (ADP-ribose) polymerase family, member 8

91 Gene Product Result for
Synonyms: ARTD16 pART16
UniProtKB ID: Q8N3A8, Q3KRB7, Q6DHZ1, Q9H754
Gene ID:
Mouse(52552) poly (ADP-ribose) polymerase family, member 8
Rat(294762) poly (ADP-ribose) polymerase family, member 8
Zebrafish(568910) poly (ADP-ribose) polymerase family, member 8
dog(479339) poly (ADP-ribose) polymerase family, member 8
domestic cat(101091257) poly (ADP-ribose) polymerase family, member 8
cow(511595) poly (ADP-ribose) polymerase family, member 8
Horse(100052543) poly (ADP-ribose) polymerase family, member 8
chicken(427198) poly (ADP-ribose) polymerase family, member 8
naked mole-rat(101705153) poly (ADP-ribose) polymerase family, member 8
Domestic Rabbit(100343313) poly (ADP-ribose) polymerase family, member 8
domestic guinea pig(100728983) poly (ADP-ribose) polymerase family, member 8
sheep(101120603) poly (ADP-ribose) polymerase family, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024615 Rosetta Predictions human pricing
XM_001068789 Rosetta Predictions rat pricing
XM_215491 Rosetta Predictions rat pricing
NM_001081009 Rosetta Predictions mouse pricing
XM_001000670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139643 predicted 1931
2 SASI_Hs01_00139644 predicted 2089
3 SASI_Hs01_00139645 predicted 2307
4 SASI_Hs01_00139646 predicted 457
5 SASI_Hs01_00139647 predicted 293
6 SASI_Hs02_00356983 predicted 1246
7 SASI_Hs01_00139648 predicted 2442
8 SASI_Hs01_00139649 predicted 1260
9 SASI_Hs01_00139650 predicted 1674
10 SASI_Hs01_00139651 predicted 494
11 SASI_Hs01_00139652 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325846 predicted 2618
2 SASI_Rn02_00325847 predicted 656
3 SASI_Rn02_00325848 predicted 2556
4 SASI_Rn02_00325849 predicted 220
5 SASI_Rn02_00325850 predicted 584
6 SASI_Rn02_00325851 predicted 2324
7 SASI_Rn02_00325852 predicted 2663
8 SASI_Rn02_00325853 predicted 1257
9 SASI_Rn02_00325854 predicted 616
10 SASI_Rn02_00325855 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376035 predicted 2881
2 SASI_Rn02_00376036 predicted 919
3 SASI_Rn02_00376037 predicted 485
4 SASI_Rn02_00376038 predicted 841
5 SASI_Rn02_00376039 predicted 2582
6 SASI_Rn02_00376040 predicted 2921
7 SASI_Rn02_00376041 predicted 1511
8 SASI_Rn02_00376042 predicted 875
9 SASI_Rn02_00376043 predicted 2568
10 SASI_Rn02_00376044 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294336 predicted 452
2 SASI_Mm02_00294337 predicted 1366
3 SASI_Mm02_00294338 predicted 945
4 SASI_Mm02_00294339 predicted 692
5 SASI_Mm02_00294340 predicted 1402
6 SASI_Mm02_00294341 predicted 1979
7 SASI_Mm02_00294342 predicted 648
8 SASI_Mm02_00294343 predicted 2557
9 SASI_Mm02_00294344 predicted 709
10 SASI_Mm02_00294345 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226500 predicted 2366
2 SASI_Mm01_00226501 predicted 1990
3 SASI_Mm01_00226502 predicted 1949
4 SASI_Mm01_00226503 predicted 2236
5 SASI_Mm01_00226504 predicted 2129
6 SASI_Mm01_00226505 predicted 2025
7 SASI_Mm01_00226506 predicted 2341
8 SASI_Mm01_00226507 predicted 2093
9 SASI_Mm01_00226508 predicted 2091
10 SASI_Mm01_00226509 predicted 1955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024615
VALIDATED
PARP8 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024615.2-2789s21c1
Sequence:CCGGTAACCCTTTGAATACTGATTTCTCGAGAAATCAGTATTCAAAGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-724s21c1
Sequence:CCGGATTCGAACAGAACCTATAATTCTCGAGAATTATAGGTTCTGTTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024615.2-1244s21c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-622s21c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-2040s21c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1170s1c1
Sequence:CCGGGCAGGCTATGACAGCAATTAACTCGAGTTAATTGCTGTCATAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-2040s1c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-622s1c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-2648s1c1
Sequence:CCGGTCCGAGTAATTGGTAATCAAACTCGAGTTTGATTACCAATTACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1244s1c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024615
VALIDATED
PARP8 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024615.2-2789s21c1
Sequence:CCGGTAACCCTTTGAATACTGATTTCTCGAGAAATCAGTATTCAAAGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-724s21c1
Sequence:CCGGATTCGAACAGAACCTATAATTCTCGAGAATTATAGGTTCTGTTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024615.2-1244s21c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-622s21c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-2040s21c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1170s1c1
Sequence:CCGGGCAGGCTATGACAGCAATTAACTCGAGTTAATTGCTGTCATAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-2040s1c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-622s1c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-2648s1c1
Sequence:CCGGTCCGAGTAATTGGTAATCAAACTCGAGTTTGATTACCAATTACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1244s1c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024615
VALIDATED
PARP8 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024615.2-2789s21c1
Sequence:CCGGTAACCCTTTGAATACTGATTTCTCGAGAAATCAGTATTCAAAGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-724s21c1
Sequence:CCGGATTCGAACAGAACCTATAATTCTCGAGAATTATAGGTTCTGTTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024615.2-1244s21c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-622s21c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024615.2-2040s21c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1170s1c1
Sequence:CCGGGCAGGCTATGACAGCAATTAACTCGAGTTAATTGCTGTCATAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-2040s1c1
Sequence:CCGGGCAATGGGTTATATCAAGTAACTCGAGTTACTTGATATAACCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-622s1c1
Sequence:CCGGGCAGTTTCTCTCAGGGAATATCTCGAGATATTCCCTGAGAGAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024615.2-2648s1c1
Sequence:CCGGTCCGAGTAATTGGTAATCAAACTCGAGTTTGATTACCAATTACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024615.2-1244s1c1
Sequence:CCGGGCCTAACTCTAAAGTCGCATACTCGAGTATGCGACTTTAGAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081009
PARP8 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2225s21c1
Sequence:CCGGTTCGGGAGCACCTTCGCATTTCTCGAGAAATGCGAAGGTGCTCCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-142s21c1
Sequence:CCGGCTCGGCCAGAGGGATTTATTTCTCGAGAAATAAATCCCTCTGGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-769s21c1
Sequence:CCGGGATTAGAACAGAACCTATTATCTCGAGATAATAGGTTCTGTTCTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2360s21c1
Sequence:CCGGCCGATGTCCAGCATATCATTTCTCGAGAAATGATATGCTGGACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081009.1-2917s21c1
Sequence:CCGGGGGTTATGGAATCTAGTAAATCTCGAGATTTACTAGATTCCATAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081009
PARP8 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2225s21c1
Sequence:CCGGTTCGGGAGCACCTTCGCATTTCTCGAGAAATGCGAAGGTGCTCCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-142s21c1
Sequence:CCGGCTCGGCCAGAGGGATTTATTTCTCGAGAAATAAATCCCTCTGGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-769s21c1
Sequence:CCGGGATTAGAACAGAACCTATTATCTCGAGATAATAGGTTCTGTTCTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2360s21c1
Sequence:CCGGCCGATGTCCAGCATATCATTTCTCGAGAAATGATATGCTGGACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081009.1-2917s21c1
Sequence:CCGGGGGTTATGGAATCTAGTAAATCTCGAGATTTACTAGATTCCATAACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081009
PARP8 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2225s21c1
Sequence:CCGGTTCGGGAGCACCTTCGCATTTCTCGAGAAATGCGAAGGTGCTCCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-142s21c1
Sequence:CCGGCTCGGCCAGAGGGATTTATTTCTCGAGAAATAAATCCCTCTGGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-769s21c1
Sequence:CCGGGATTAGAACAGAACCTATTATCTCGAGATAATAGGTTCTGTTCTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081009.1-2360s21c1
Sequence:CCGGCCGATGTCCAGCATATCATTTCTCGAGAAATGATATGCTGGACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081009.1-2917s21c1
Sequence:CCGGGGGTTATGGAATCTAGTAAATCTCGAGATTTACTAGATTCCATAACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)