EMAIL THIS PAGE TO A FRIEND

PARP9

poly (ADP-ribose) polymerase family, member 9

127 Gene Product Result for
Synonyms: ARTD9 BAL BAL1 MGC:7868
Gene ID:
Mouse(80285) poly (ADP-ribose) polymerase family, member 9
Rat(303905) poly (ADP-ribose) polymerase family, member 9
sheep(101114071) poly (ADP-ribose) polymerase family, member 9
domestic guinea pig(100717525) poly (ADP-ribose) polymerase family, member 9
naked mole-rat(101707607) poly (ADP-ribose) polymerase family, member 9
chicken(424269) poly (ADP-ribose) polymerase family, member 9
dog(488010) poly (ADP-ribose) polymerase family, member 9
cow(510532) poly (ADP-ribose) polymerase family, member 9
Horse(100070607) poly (ADP-ribose) polymerase family, member 9
domestic cat(101091136) poly (ADP-ribose) polymerase family, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031458 Rosetta Predictions human pricing
NM_001103351 Rosetta Predictions rat pricing
NM_030253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089429 predicted 1449
2 SASI_Hs01_00089430 predicted 642
3 SASI_Hs01_00089431 predicted 2817
4 SASI_Hs02_00358880 predicted 1303
5 SASI_Hs01_00089433 predicted 1850
6 SASI_Hs01_00089434 predicted 2877
7 SASI_Hs01_00089435 predicted 1046
8 SASI_Hs01_00089437 predicted 1757
9 SASI_Hs01_00089438 predicted 1201
10 SASI_Hs02_00358881 predicted 2217
11 SASI_Hs01_00089432 predicted 2734
12 SASI_Hs01_00089436 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211504 predicted 923
2 SASI_Rn02_00211505 predicted 289
3 SASI_Rn02_00211506 predicted 364
4 SASI_Rn02_00211507 predicted 1895
5 SASI_Rn02_00211508 predicted 1569
6 SASI_Rn02_00211509 predicted 2640
7 SASI_Rn02_00211510 predicted 2767
8 SASI_Rn02_00211511 predicted 1987
9 SASI_Rn02_00211512 predicted 378
10 SASI_Rn02_00211513 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109972 predicted 1831
2 SASI_Mm01_00109973 predicted 2044
3 SASI_Mm01_00109974 predicted 2908
4 SASI_Mm01_00109975 predicted 1201
5 SASI_Mm01_00109976 predicted 714
6 SASI_Mm02_00336722 predicted 2848
7 SASI_Mm01_00109978 predicted 2748
8 SASI_Mm01_00109979 predicted 3164
9 SASI_Mm01_00109980 predicted 2759
10 SASI_Mm01_00109981 predicted 795
11 SASI_Mm01_00109977 predicted 1577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031458
VALIDATED
PARP9 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-2922s21c1
Sequence:CCGGCCTTACCTTGGGTGAACTAACCTCGAGGTTAGTTCACCCAAGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-1314s21c1
Sequence:CCGGGACGGCAGATGTAATTGTTAACTCGAGTTAACAATTACATCTGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-668s21c1
Sequence:CCGGTGACTCCTAGGATAGAGTTATCTCGAGATAACTCTATCCTAGGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2192s21c1
Sequence:CCGGCGTTAGGACAGTGGACTATTCCTCGAGGAATAGTCCACTGTCCTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-3148s21c1
Sequence:CCGGCCTTTACTAGAGGAGATAAATCTCGAGATTTATCTCCTCTAGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2641s21c1
Sequence:CCGGTGCCAGGGACATCCGTTAAATCTCGAGATTTAACGGATGTCCCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-2226s1c1
Sequence:CCGGGCAGGTTCTAAAGGTGGAGAACTCGAGTTCTCCACCTTTAGAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-1273s1c1
Sequence:CCGGGCAAAGTCAATTCTACAACAACTCGAGTTGTTGTAGAATTGACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-2627s1c1
Sequence:CCGGCCAGCCCTGAAACCTTTGTTACTCGAGTAACAAAGGTTTCAGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-483s1c1
Sequence:CCGGCCAGAATAAGTTTGGCTGTATCTCGAGATACAGCCAAACTTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031458
VALIDATED
PARP9 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-2922s21c1
Sequence:CCGGCCTTACCTTGGGTGAACTAACCTCGAGGTTAGTTCACCCAAGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-1314s21c1
Sequence:CCGGGACGGCAGATGTAATTGTTAACTCGAGTTAACAATTACATCTGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-668s21c1
Sequence:CCGGTGACTCCTAGGATAGAGTTATCTCGAGATAACTCTATCCTAGGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2192s21c1
Sequence:CCGGCGTTAGGACAGTGGACTATTCCTCGAGGAATAGTCCACTGTCCTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-3148s21c1
Sequence:CCGGCCTTTACTAGAGGAGATAAATCTCGAGATTTATCTCCTCTAGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2641s21c1
Sequence:CCGGTGCCAGGGACATCCGTTAAATCTCGAGATTTAACGGATGTCCCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-2226s1c1
Sequence:CCGGGCAGGTTCTAAAGGTGGAGAACTCGAGTTCTCCACCTTTAGAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-1273s1c1
Sequence:CCGGGCAAAGTCAATTCTACAACAACTCGAGTTGTTGTAGAATTGACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-2627s1c1
Sequence:CCGGCCAGCCCTGAAACCTTTGTTACTCGAGTAACAAAGGTTTCAGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-483s1c1
Sequence:CCGGCCAGAATAAGTTTGGCTGTATCTCGAGATACAGCCAAACTTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031458
VALIDATED
PARP9 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-2922s21c1
Sequence:CCGGCCTTACCTTGGGTGAACTAACCTCGAGGTTAGTTCACCCAAGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-1314s21c1
Sequence:CCGGGACGGCAGATGTAATTGTTAACTCGAGTTAACAATTACATCTGCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-668s21c1
Sequence:CCGGTGACTCCTAGGATAGAGTTATCTCGAGATAACTCTATCCTAGGAGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2192s21c1
Sequence:CCGGCGTTAGGACAGTGGACTATTCCTCGAGGAATAGTCCACTGTCCTAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031458.2-3148s21c1
Sequence:CCGGCCTTTACTAGAGGAGATAAATCTCGAGATTTATCTCCTCTAGTAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031458.2-2641s21c1
Sequence:CCGGTGCCAGGGACATCCGTTAAATCTCGAGATTTAACGGATGTCCCTGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-2226s1c1
Sequence:CCGGGCAGGTTCTAAAGGTGGAGAACTCGAGTTCTCCACCTTTAGAACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-1273s1c1
Sequence:CCGGGCAAAGTCAATTCTACAACAACTCGAGTTGTTGTAGAATTGACTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031458.1-2627s1c1
Sequence:CCGGCCAGCCCTGAAACCTTTGTTACTCGAGTAACAAAGGTTTCAGGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031458.1-483s1c1
Sequence:CCGGCCAGAATAAGTTTGGCTGTATCTCGAGATACAGCCAAACTTATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030253
VALIDATED
PARP9 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase family, member 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-2208s1c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-693s1c1
Sequence:CCGGCCAAATATGATCTACGCATTACTCGAGTAATGCGTAGATCATATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1005s1c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-185s1c1
Sequence:CCGGGAAGAACATTATAGATGGCAACTCGAGTTGCCATCTATAATGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-584s1c1
Sequence:CCGGCCTTGCCATTTGATTATCCATCTCGAGATGGATAATCAAATGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030253.2-3383s1c1
Sequence:CCGGCTATAGGTGACAGCAAGAATACTCGAGTATTCTTGCTGTCACCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-3271s21c1
Sequence:CCGGGACCACACACTAGCATCATAGCTCGAGCTATGATGCTAGTGTGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1372s21c1
Sequence:CCGGCAAGCAAATGTTCGGTAATTTCTCGAGAAATTACCGAACATTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1563s21c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2766s21c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2534s21c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1976s1c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030253
VALIDATED
PARP9 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase family, member 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-2208s1c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-693s1c1
Sequence:CCGGCCAAATATGATCTACGCATTACTCGAGTAATGCGTAGATCATATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1005s1c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-185s1c1
Sequence:CCGGGAAGAACATTATAGATGGCAACTCGAGTTGCCATCTATAATGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-584s1c1
Sequence:CCGGCCTTGCCATTTGATTATCCATCTCGAGATGGATAATCAAATGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030253.2-3383s1c1
Sequence:CCGGCTATAGGTGACAGCAAGAATACTCGAGTATTCTTGCTGTCACCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-3271s21c1
Sequence:CCGGGACCACACACTAGCATCATAGCTCGAGCTATGATGCTAGTGTGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1372s21c1
Sequence:CCGGCAAGCAAATGTTCGGTAATTTCTCGAGAAATTACCGAACATTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1563s21c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2766s21c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2534s21c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1976s1c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030253
VALIDATED
PARP9 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase family, member 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-2208s1c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-693s1c1
Sequence:CCGGCCAAATATGATCTACGCATTACTCGAGTAATGCGTAGATCATATTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1005s1c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-185s1c1
Sequence:CCGGGAAGAACATTATAGATGGCAACTCGAGTTGCCATCTATAATGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030253.1-584s1c1
Sequence:CCGGCCTTGCCATTTGATTATCCATCTCGAGATGGATAATCAAATGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030253.2-3383s1c1
Sequence:CCGGCTATAGGTGACAGCAAGAATACTCGAGTATTCTTGCTGTCACCTATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-3271s21c1
Sequence:CCGGGACCACACACTAGCATCATAGCTCGAGCTATGATGCTAGTGTGTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1372s21c1
Sequence:CCGGCAAGCAAATGTTCGGTAATTTCTCGAGAAATTACCGAACATTTGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-1563s21c1
Sequence:CCGGGCTGTATTGAAATGCAAACAACTCGAGTTGTTTGCATTTCAATACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2766s21c1
Sequence:CCGGCGACATCCTATAACCCAGTTTCTCGAGAAACTGGGTTATAGGATGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030253.2-2534s21c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030253.1-1976s1c1
Sequence:CCGGGCATCATTAACTCAGGAACTTCTCGAGAAGTTCCTGAGTTAATGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)