EMAIL THIS PAGE TO A FRIEND

PARPBP

PARP1 binding protein

108 Gene Product Result for
Synonyms: AROM C12orf48 PARI
Gene ID:
Mouse(75317) PARP1 binding protein
Rat(100310874) PARP1 binding protein
Zebrafish(678635) PARP1 binding protein
cow(615510) PARP1 binding protein
domestic cat(101081480) PARP1 binding protein
dog(612196) PARP1 binding protein
naked mole-rat(101708284) PARP1 binding protein
domestic guinea pig(100728642) PARP1 binding protein
sheep(101110135) PARP1 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039677 Anti-PARPBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017915 Rosetta Predictions human pricing
NM_029249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163186 predicted 682
2 SASI_Hs01_00163187 predicted 600
3 SASI_Hs01_00163188 predicted 1061
4 SASI_Hs01_00163189 predicted 1265
5 SASI_Hs02_00350902 predicted 1139
6 SASI_Hs01_00163190 predicted 1849
7 SASI_Hs01_00163191 predicted 1206
8 SASI_Hs01_00163192 predicted 1188
9 SASI_Hs01_00163193 predicted 1819
10 SASI_Hs01_00163194 predicted 963
11 SASI_Hs01_00163195 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335023 predicted 758
2 SASI_Mm01_00177111 predicted 722
3 SASI_Mm01_00177112 predicted 825
4 SASI_Mm01_00177113 predicted 800
5 SASI_Mm02_00335024 predicted 1083
6 SASI_Mm01_00177114 predicted 1771
7 SASI_Mm01_00177115 predicted 1969
8 SASI_Mm01_00177116 predicted 1814
9 SASI_Mm01_00177117 predicted 1218
10 SASI_Mm01_00177118 predicted 855
11 SASI_Mm01_00177119 predicted 1608
12 SASI_Mm01_00177120 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029249
VALIDATED
PARPBP MISSION shRNA Bacterial Glycerol Stock
PARP1 binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1277s21c1
Sequence:CCGGTCGGATATTATCAGCGATAAACTCGAGTTTATCGCTGATAATATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029249.2-2530s21c1
Sequence:CCGGTTGAGGTCCAGTGGGTTATTACTCGAGTAATAACCCACTGGACCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029249.2-652s21c1
Sequence:CCGGAGTACTTCTTACACGAGAAACCTCGAGGTTTCTCGTGTAAGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1105s21c1
Sequence:CCGGTTCTGATGGCCACGTCATTTACTCGAGTAAATGACGTGGCCATCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-791s21c1
Sequence:CCGGTAGCAGCTTGACCTCTAATTACTCGAGTAATTAGAGGTCAAGCTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029249
VALIDATED
PARPBP MISSION shRNA shRNA Plasmid DNA
PARP1 binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1277s21c1
Sequence:CCGGTCGGATATTATCAGCGATAAACTCGAGTTTATCGCTGATAATATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029249.2-2530s21c1
Sequence:CCGGTTGAGGTCCAGTGGGTTATTACTCGAGTAATAACCCACTGGACCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029249.2-652s21c1
Sequence:CCGGAGTACTTCTTACACGAGAAACCTCGAGGTTTCTCGTGTAAGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1105s21c1
Sequence:CCGGTTCTGATGGCCACGTCATTTACTCGAGTAAATGACGTGGCCATCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-791s21c1
Sequence:CCGGTAGCAGCTTGACCTCTAATTACTCGAGTAATTAGAGGTCAAGCTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029249
VALIDATED
PARPBP MISSION shRNA Lentiviral Transduction Particles
PARP1 binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1277s21c1
Sequence:CCGGTCGGATATTATCAGCGATAAACTCGAGTTTATCGCTGATAATATCCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029249.2-2530s21c1
Sequence:CCGGTTGAGGTCCAGTGGGTTATTACTCGAGTAATAACCCACTGGACCTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029249.2-652s21c1
Sequence:CCGGAGTACTTCTTACACGAGAAACCTCGAGGTTTCTCGTGTAAGAAGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-1105s21c1
Sequence:CCGGTTCTGATGGCCACGTCATTTACTCGAGTAAATGACGTGGCCATCAGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029249.2-791s21c1
Sequence:CCGGTAGCAGCTTGACCTCTAATTACTCGAGTAATTAGAGGTCAAGCTGCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017915
VALIDATED
PARPBP MISSION shRNA Bacterial Glycerol Stock
PARP1 binding protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1437s1c1
Sequence:CCGGGAGGGTGTAAATCCATCTGTTCTCGAGAACAGATGGATTTACACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017915.1-1089s1c1
Sequence:CCGGGATACTGTGAAAGCCTTATTACTCGAGTAATAAGGCTTTCACAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1685s1c1
Sequence:CCGGCAAACTAGCTAAAGTAGCAAACTCGAGTTTGCTACTTTAGCTAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1176s1c1
Sequence:CCGGGAAGACACAATCCATCATCATCTCGAGATGATGATGGATTGTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-689s21c1
Sequence:CCGGAGTAAATACAACCGTGATAATCTCGAGATTATCACGGTTGTATTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1610s21c1
Sequence:CCGGGACCTTTCTGAGGGTGTAAATCTCGAGATTTACACCCTCAGAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1794s1c1
Sequence:CCGGGCTTTAGGTTTATGCATCTATCTCGAGATAGATGCATAAACCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1903s1c1
Sequence:CCGGGTTAGTATGTTAAGCACTGTTCTCGAGAACAGTGCTTAACATACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1818s1c1
Sequence:CCGGCCATTCACCAAAGACATGCTTCTCGAGAAGCATGTCTTTGGTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017915.2-2257s21c1
Sequence:CCGCCTCCTCCCATTGGCAATTAAACTCGAGTTTAATTGCCAATGGGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1370s21c1
Sequence:CCGGCATCATCATGGAACGTCTATTCTCGAGAATAGACGTTCCATGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017915
VALIDATED
PARPBP MISSION shRNA shRNA Plasmid DNA
PARP1 binding protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1437s1c1
Sequence:CCGGGAGGGTGTAAATCCATCTGTTCTCGAGAACAGATGGATTTACACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017915.1-1089s1c1
Sequence:CCGGGATACTGTGAAAGCCTTATTACTCGAGTAATAAGGCTTTCACAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1685s1c1
Sequence:CCGGCAAACTAGCTAAAGTAGCAAACTCGAGTTTGCTACTTTAGCTAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1176s1c1
Sequence:CCGGGAAGACACAATCCATCATCATCTCGAGATGATGATGGATTGTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-689s21c1
Sequence:CCGGAGTAAATACAACCGTGATAATCTCGAGATTATCACGGTTGTATTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1610s21c1
Sequence:CCGGGACCTTTCTGAGGGTGTAAATCTCGAGATTTACACCCTCAGAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1794s1c1
Sequence:CCGGGCTTTAGGTTTATGCATCTATCTCGAGATAGATGCATAAACCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1903s1c1
Sequence:CCGGGTTAGTATGTTAAGCACTGTTCTCGAGAACAGTGCTTAACATACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1818s1c1
Sequence:CCGGCCATTCACCAAAGACATGCTTCTCGAGAAGCATGTCTTTGGTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017915.2-2257s21c1
Sequence:CCGCCTCCTCCCATTGGCAATTAAACTCGAGTTTAATTGCCAATGGGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1370s21c1
Sequence:CCGGCATCATCATGGAACGTCTATTCTCGAGAATAGACGTTCCATGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017915
VALIDATED
PARPBP MISSION shRNA Lentiviral Transduction Particles
PARP1 binding protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1437s1c1
Sequence:CCGGGAGGGTGTAAATCCATCTGTTCTCGAGAACAGATGGATTTACACCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017915.1-1089s1c1
Sequence:CCGGGATACTGTGAAAGCCTTATTACTCGAGTAATAAGGCTTTCACAGTATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1685s1c1
Sequence:CCGGCAAACTAGCTAAAGTAGCAAACTCGAGTTTGCTACTTTAGCTAGTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1176s1c1
Sequence:CCGGGAAGACACAATCCATCATCATCTCGAGATGATGATGGATTGTGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-689s21c1
Sequence:CCGGAGTAAATACAACCGTGATAATCTCGAGATTATCACGGTTGTATTTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1610s21c1
Sequence:CCGGGACCTTTCTGAGGGTGTAAATCTCGAGATTTACACCCTCAGAAAGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1794s1c1
Sequence:CCGGGCTTTAGGTTTATGCATCTATCTCGAGATAGATGCATAAACCTAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1903s1c1
Sequence:CCGGGTTAGTATGTTAAGCACTGTTCTCGAGAACAGTGCTTAACATACTAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017915.1-1818s1c1
Sequence:CCGGCCATTCACCAAAGACATGCTTCTCGAGAAGCATGTCTTTGGTGAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017915.2-2257s21c1
Sequence:CCGCCTCCTCCCATTGGCAATTAAACTCGAGTTTAATTGCCAATGGGAGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017915.2-1370s21c1
Sequence:CCGGCATCATCATGGAACGTCTATTCTCGAGAATAGACGTTCCATGATGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???