EMAIL THIS PAGE TO A FRIEND

PARVA

parvin, alpha

165 Gene Product Result for
Synonyms: CH-ILKBP MXRA2
UniProtKB ID: Q9NVD7, Q96C85, Q9HA48
Gene ID:
Human(55742) Summary: This gene encodes a member of the parvin family of actin-binding proteins. Parvins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. The encoded protein is part of the integrin-linked kinase signaling complex and plays a role in cell adhesion, motility and survival. [provided by RefSeq, Dec 2010]
Mouse(57342) parvin, alpha
Rat(57341) parvin, alpha
Zebrafish(100331103) parvin, alpha
chicken(423030) parvin, alpha
cow(615430) parvin, alpha
Horse(100071481) parvin, alpha
domestic cat(101091474) parvin, alpha
dog(476859) parvin, alpha
sheep(101121625) parvin, alpha
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018222 Rosetta Predictions human pricing
NM_020656 Rosetta Predictions rat pricing
NM_020606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165014 predicted 287
2 SASI_Hs01_00165015 predicted 329
3 SASI_Hs02_00351533 predicted 386
4 SASI_Hs01_00165016 predicted 763
5 SASI_Hs01_00165018 predicted 845
6 SASI_Hs01_00165019 predicted 1003
7 SASI_Hs01_00165020 predicted 566
8 SASI_Hs01_00165021 predicted 1142
9 SASI_Hs01_00165022 predicted 708
10 SASI_Hs01_00165023 predicted 858
11 SASI_Hs01_00165017 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117135 predicted 236
2 SASI_Rn01_00117136 predicted 246
3 SASI_Rn01_00117138 predicted 349
4 SASI_Rn02_00262562 predicted 738
5 SASI_Rn01_00117139 predicted 709
6 SASI_Rn01_00117140 predicted 614
7 SASI_Rn01_00117141 predicted 517
8 SASI_Rn01_00117142 predicted 815
9 SASI_Rn01_00117143 predicted 713
10 SASI_Rn01_00117144 predicted 726
11 SASI_Rn01_00117137 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126293 predicted 1068
2 SASI_Mm01_00126294 predicted 493
3 SASI_Mm01_00126295 predicted 573
4 SASI_Mm01_00126296 predicted 1002
5 SASI_Mm01_00126298 predicted 1348
6 SASI_Mm01_00126299 predicted 800
7 SASI_Mm01_00126300 predicted 1258
8 SASI_Mm01_00126301 predicted 1063
9 SASI_Mm01_00126302 predicted 771
10 SASI_Mm02_00325713 predicted 409
11 SASI_Mm01_00126297 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018222
PARVA MISSION shRNA Bacterial Glycerol Stock
parvin, alpha
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1556s21c1
Sequence:CCGGGATATACTCAAGGCCATTAATCTCGAGATTAATGGCCTTGAGTATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-289s21c1
Sequence:CCGGGCGAACAATGGTGGATCCAAACTCGAGTTTGGATCCACCATTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-334s21c1
Sequence:CCGGAGAACTGATGAAGGTATTAATCTCGAGATTAATACCTTCATCAGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-537s21c1
Sequence:CCGGAGATCAATGAAACCCTGAAACCTCGAGGTTTCAGGGTTTCATTGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1630s21c1
Sequence:CCGGACTAAGGCTTGGAGGTTAAATCTCGAGATTTAACCTCCAAGCCTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-644s21c1
Sequence:CCGGCAGTATTTCCGCGCACCAATTCTCGAGAATTGGTGCGCGGAAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018222.2-2439s1c1
Sequence:CCGGCGGCTAATTCAAGCGAGGAAACTCGAGTTTCCTCGCTTGAATTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-796s1c1
Sequence:CCGGCTGGTAACACAGAGGCTCTTTCTCGAGAAAGAGCCTCTGTGTTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-154s1c1
Sequence:CCGGCGTCCCGCAAGAAAGATGATTCTCGAGAATCATCTTTCTTGCGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-1096s21c1
Sequence:CCGGAGTCAACTGTGACCTGAAATCCTCGAGGATTTCAGGTCACAGTTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-1181s1c1
Sequence:CCGGCCTCTTCACCAAGTACCGTAACTCGAGTTACGGTACTTGGTGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-732s1c1
Sequence:CCGGCAAGTGGTTGTGGTCCAGAAACTCGAGTTTCTGGACCACAACCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-719s21c1
Sequence:CCGGATCCTCCAGTCTCGGCAAATCCTCGAGGATTTGCCGAGACTGGAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018222
PARVA MISSION shRNA shRNA Plasmid DNA
parvin, alpha
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1556s21c1
Sequence:CCGGGATATACTCAAGGCCATTAATCTCGAGATTAATGGCCTTGAGTATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-289s21c1
Sequence:CCGGGCGAACAATGGTGGATCCAAACTCGAGTTTGGATCCACCATTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-334s21c1
Sequence:CCGGAGAACTGATGAAGGTATTAATCTCGAGATTAATACCTTCATCAGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-537s21c1
Sequence:CCGGAGATCAATGAAACCCTGAAACCTCGAGGTTTCAGGGTTTCATTGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1630s21c1
Sequence:CCGGACTAAGGCTTGGAGGTTAAATCTCGAGATTTAACCTCCAAGCCTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-644s21c1
Sequence:CCGGCAGTATTTCCGCGCACCAATTCTCGAGAATTGGTGCGCGGAAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018222.2-2439s1c1
Sequence:CCGGCGGCTAATTCAAGCGAGGAAACTCGAGTTTCCTCGCTTGAATTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-796s1c1
Sequence:CCGGCTGGTAACACAGAGGCTCTTTCTCGAGAAAGAGCCTCTGTGTTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-154s1c1
Sequence:CCGGCGTCCCGCAAGAAAGATGATTCTCGAGAATCATCTTTCTTGCGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-1096s21c1
Sequence:CCGGAGTCAACTGTGACCTGAAATCCTCGAGGATTTCAGGTCACAGTTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-1181s1c1
Sequence:CCGGCCTCTTCACCAAGTACCGTAACTCGAGTTACGGTACTTGGTGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-732s1c1
Sequence:CCGGCAAGTGGTTGTGGTCCAGAAACTCGAGTTTCTGGACCACAACCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-719s21c1
Sequence:CCGGATCCTCCAGTCTCGGCAAATCCTCGAGGATTTGCCGAGACTGGAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018222
PARVA MISSION shRNA Lentiviral Transduction Particles
parvin, alpha
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1556s21c1
Sequence:CCGGGATATACTCAAGGCCATTAATCTCGAGATTAATGGCCTTGAGTATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-289s21c1
Sequence:CCGGGCGAACAATGGTGGATCCAAACTCGAGTTTGGATCCACCATTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-334s21c1
Sequence:CCGGAGAACTGATGAAGGTATTAATCTCGAGATTAATACCTTCATCAGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-537s21c1
Sequence:CCGGAGATCAATGAAACCCTGAAACCTCGAGGTTTCAGGGTTTCATTGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018222.3-1630s21c1
Sequence:CCGGACTAAGGCTTGGAGGTTAAATCTCGAGATTTAACCTCCAAGCCTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-644s21c1
Sequence:CCGGCAGTATTTCCGCGCACCAATTCTCGAGAATTGGTGCGCGGAAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018222.2-2439s1c1
Sequence:CCGGCGGCTAATTCAAGCGAGGAAACTCGAGTTTCCTCGCTTGAATTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-796s1c1
Sequence:CCGGCTGGTAACACAGAGGCTCTTTCTCGAGAAAGAGCCTCTGTGTTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-154s1c1
Sequence:CCGGCGTCCCGCAAGAAAGATGATTCTCGAGAATCATCTTTCTTGCGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-1096s21c1
Sequence:CCGGAGTCAACTGTGACCTGAAATCCTCGAGGATTTCAGGTCACAGTTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-1181s1c1
Sequence:CCGGCCTCTTCACCAAGTACCGTAACTCGAGTTACGGTACTTGGTGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018222.2-732s1c1
Sequence:CCGGCAAGTGGTTGTGGTCCAGAAACTCGAGTTTCTGGACCACAACCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018222.3-719s21c1
Sequence:CCGGATCCTCCAGTCTCGGCAAATCCTCGAGGATTTGCCGAGACTGGAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020606
VALIDATED
PARVA MISSION shRNA Bacterial Glycerol Stock
parvin, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-565s21c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-939s21c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020606.5-1821s21c1
Sequence:CCGGGCGAAGGTTTGCTATCCATTACTCGAGTAATGGATAGCAAACCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-1324s21c1
Sequence:CCGGGTCCACGCTGAGAGTGCTATACTCGAGTATAGCACTCTCAGCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1001s1c1
Sequence:CCGGGATGCCTTTGACACGCTGTTTCTCGAGAAACAGCGTGTCAAAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1069s1c1
Sequence:CCGGGTTCGTGAACAAGCATCTGAACTCGAGTTCAGATGCTTGTTCACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020606.4-565s1c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-939s1c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020606.4-2484s1c1
Sequence:CCGGGCGTGGAGAATGTCAGTCATTCTCGAGAATGACTGACATTCTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020606
VALIDATED
PARVA MISSION shRNA shRNA Plasmid DNA
parvin, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-565s21c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-939s21c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020606.5-1821s21c1
Sequence:CCGGGCGAAGGTTTGCTATCCATTACTCGAGTAATGGATAGCAAACCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-1324s21c1
Sequence:CCGGGTCCACGCTGAGAGTGCTATACTCGAGTATAGCACTCTCAGCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1001s1c1
Sequence:CCGGGATGCCTTTGACACGCTGTTTCTCGAGAAACAGCGTGTCAAAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1069s1c1
Sequence:CCGGGTTCGTGAACAAGCATCTGAACTCGAGTTCAGATGCTTGTTCACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020606.4-565s1c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-939s1c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020606.4-2484s1c1
Sequence:CCGGGCGTGGAGAATGTCAGTCATTCTCGAGAATGACTGACATTCTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020606
VALIDATED
PARVA MISSION shRNA Lentiviral Transduction Particles
parvin, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-565s21c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-939s21c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020606.5-1821s21c1
Sequence:CCGGGCGAAGGTTTGCTATCCATTACTCGAGTAATGGATAGCAAACCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020606.5-1324s21c1
Sequence:CCGGGTCCACGCTGAGAGTGCTATACTCGAGTATAGCACTCTCAGCGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1001s1c1
Sequence:CCGGGATGCCTTTGACACGCTGTTTCTCGAGAAACAGCGTGTCAAAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-1069s1c1
Sequence:CCGGGTTCGTGAACAAGCATCTGAACTCGAGTTCAGATGCTTGTTCACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020606.4-565s1c1
Sequence:CCGGCGACTGGATCAATGACGTATTCTCGAGAATACGTCATTGATCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020606.4-939s1c1
Sequence:CCGGCTCGACAAATCCAAGAGGAAACTCGAGTTTCCTCTTGGATTTGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020606.4-2484s1c1
Sequence:CCGGGCGTGGAGAATGTCAGTCATTCTCGAGAATGACTGACATTCTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)