EMAIL THIS PAGE TO A FRIEND

PARVB

parvin, beta

67 Gene Product Result for
Synonyms: CGI-56
Gene ID:
Human(29780) Summary: This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(170736) parvin, beta
Rat(362973) parvin, beta
Zebrafish(325686) parvin, beta
cow(616294) parvin, beta
dog(481215) parvin, beta
chicken(418235) parvin, beta
sheep(101118176) parvin, beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003828 Rosetta Predictions human pricing
NM_013327 Rosetta Predictions human pricing
NM_001134780 Rosetta Predictions rat pricing
XM_001078155 Rosetta Predictions rat pricing
NM_133167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196771 predicted 1150
2 SASI_Hs01_00196773 predicted 1507
3 SASI_Hs01_00196774 predicted 1475
4 SASI_Hs01_00196776 predicted 904
5 SASI_Hs01_00196777 predicted 458
6 SASI_Hs01_00196778 predicted 1063
7 SASI_Hs02_00304408 predicted 815
8 SASI_Hs01_00196779 predicted 1518
9 SASI_Hs01_00196780 predicted 1075
10 SASI_Hs02_00304409 predicted 561
11 SASI_Hs01_00196772 predicted 918
12 SASI_Hs01_00196775 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050404 predicted 1053
2 SASI_Hs01_00050406 predicted 1407
3 SASI_Hs01_00050407 predicted 1381
4 SASI_Hs01_00050409 predicted 806
5 SASI_Hs01_00050410 predicted 364
6 SASI_Hs01_00050411 predicted 968
7 SASI_Hs02_00344632 predicted 722
8 SASI_Hs01_00050412 predicted 1428
9 SASI_Hs01_00050413 predicted 975
10 SASI_Hs02_00344633 predicted 469
11 SASI_Hs01_00050405 predicted 818
12 SASI_Hs01_00050408 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258484 predicted 553
2 SASI_Rn02_00258485 predicted 533
3 SASI_Rn02_00258486 predicted 345
4 SASI_Rn02_00258487 predicted 1039
5 SASI_Rn02_00258488 predicted 876
6 SASI_Rn02_00258489 predicted 959
7 SASI_Rn02_00258490 predicted 1096
8 SASI_Rn02_00258491 predicted 449
9 SASI_Rn02_00258492 predicted 820
10 SASI_Rn02_00258493 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359829 predicted 557
2 SASI_Rn02_00359830 predicted 532
3 SASI_Rn02_00359831 predicted 344
4 SASI_Rn02_00359832 predicted 1038
5 SASI_Rn02_00359833 predicted 882
6 SASI_Rn02_00359834 predicted 956
7 SASI_Rn02_00359835 predicted 1104
8 SASI_Rn02_00359836 predicted 451
9 SASI_Rn02_00359837 predicted 817
10 SASI_Rn02_00359838 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168111 predicted 945
2 SASI_Mm01_00168112 predicted 823
3 SASI_Mm01_00168113 predicted 327
4 SASI_Mm01_00168115 predicted 289
5 SASI_Mm01_00168116 predicted 880
6 SASI_Mm02_00338340 predicted 807
7 SASI_Mm01_00168117 predicted 457
8 SASI_Mm01_00168118 predicted 963
9 SASI_Mm01_00168120 predicted 877
10 SASI_Mm02_00338341 predicted 302
11 SASI_Mm01_00168114 predicted 985
12 SASI_Mm01_00168119 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013327
VALIDATED
PARVB MISSION shRNA Bacterial Glycerol Stock
parvin, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1072s1c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-985s21c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1117s1c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-1249s1c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-985s1c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-470s1c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-470s21c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1117s21c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013327.3-1249s21c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1072s21c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013327
VALIDATED
PARVB MISSION shRNA shRNA Plasmid DNA
parvin, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1072s1c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-985s21c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1117s1c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-1249s1c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-985s1c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-470s1c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-470s21c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1117s21c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013327.3-1249s21c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1072s21c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013327
VALIDATED
PARVB MISSION shRNA Lentiviral Transduction Particles
parvin, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1072s1c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-985s21c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-1117s1c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-1249s1c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013327.3-985s1c1
Sequence:CCGGCTTCGATCAGAAGGTCCACAACTCGAGTTGTGGACCTTCTGATCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013327.3-470s1c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-470s21c1
Sequence:CCGGCAGTCCGAAATAGGGCAGAAACTCGAGTTTCTGCCCTATTTCGGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1117s21c1
Sequence:CCGGCCTGTTCACCAAGTACAAGAACTCGAGTTCTTGTACTTGGTGAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013327.3-1249s21c1
Sequence:CCGGCCAAGCTGTGTTGACTGTCATCTCGAGATGACAGTCAACACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013327.3-1072s21c1
Sequence:CCGGCGTGGTTAACTTGGACCTCAACTCGAGTTGAGGTCCAAGTTAACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133167
PARVB MISSION shRNA Bacterial Glycerol Stock
parvin, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-725s1c1
Sequence:CCGGCGGGACGCCTTCGATACTCTTCTCGAGAAGAGTATCGAAGGCGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-857s1c1
Sequence:CCGGGCAGATGGTGTGTACCTAGTTCTCGAGAACTAGGTACACACCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-805s1c1
Sequence:CCGGCAAACACCTGAATAAGCTAAACTCGAGTTTAGCTTATTCAGGTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-52s1c1
Sequence:CCGGGATGAAGAAGGACGAGTCTTTCTCGAGAAAGACTCGTCCTTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-808s1c1
Sequence:CCGGACACCTGAATAAGCTAAACTTCTCGAGAAGTTTAGCTTATTCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133167
PARVB MISSION shRNA shRNA Plasmid DNA
parvin, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-725s1c1
Sequence:CCGGCGGGACGCCTTCGATACTCTTCTCGAGAAGAGTATCGAAGGCGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-857s1c1
Sequence:CCGGGCAGATGGTGTGTACCTAGTTCTCGAGAACTAGGTACACACCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-805s1c1
Sequence:CCGGCAAACACCTGAATAAGCTAAACTCGAGTTTAGCTTATTCAGGTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-52s1c1
Sequence:CCGGGATGAAGAAGGACGAGTCTTTCTCGAGAAAGACTCGTCCTTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-808s1c1
Sequence:CCGGACACCTGAATAAGCTAAACTTCTCGAGAAGTTTAGCTTATTCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133167
PARVB MISSION shRNA Lentiviral Transduction Particles
parvin, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-725s1c1
Sequence:CCGGCGGGACGCCTTCGATACTCTTCTCGAGAAGAGTATCGAAGGCGTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-857s1c1
Sequence:CCGGGCAGATGGTGTGTACCTAGTTCTCGAGAACTAGGTACACACCATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-805s1c1
Sequence:CCGGCAAACACCTGAATAAGCTAAACTCGAGTTTAGCTTATTCAGGTGTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-52s1c1
Sequence:CCGGGATGAAGAAGGACGAGTCTTTCTCGAGAAAGACTCGTCCTTCTTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133167.2-808s1c1
Sequence:CCGGACACCTGAATAAGCTAAACTTCTCGAGAAGTTTAGCTTATTCAGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)