EMAIL THIS PAGE TO A FRIEND

PASD1

PAS domain containing 1

26 Gene Product Result for
Synonyms: CT63 OXTES1
UniProtKB ID: Q8IV76, Q3MNE0, Q69HD7, Q8N7X9
Gene ID:
Human(139135) Summary: This gene encodes a protein that is thought to function as a transcription factor. The protein is a cancer-associated antigen that can stimulate autologous T-cell responses, and it is therefore considered to be a potential immunotherapeutic target for the treatment of various hematopoietic malignancies, including diffuse large B-cell lymphoma. [provided by RefSeq, May 2010]
chicken(422384) PAS domain containing 1
domestic cat(101098937) PAS domain containing 1
cow(784732) PAS domain containing 1
dog(492216) PAS domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135894 predicted 2644
2 SASI_Hs01_00135895 predicted 2413
3 SASI_Hs01_00135896 predicted 2720
4 SASI_Hs01_00135897 predicted 1526
5 SASI_Hs01_00135899 predicted 1405
6 SASI_Hs01_00135900 predicted 438
7 SASI_Hs01_00135901 predicted 689
8 SASI_Hs01_00135902 predicted 1410
9 SASI_Hs01_00135903 predicted 1426
10 SASI_Hs02_00368258 predicted 453
11 SASI_Hs01_00135898 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173493
PASD1 MISSION shRNA Bacterial Glycerol Stock
PAS domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173493.1-2846s1c1
Sequence:CCGGGCTTTGCATATCCATGTTCTACTCGAGTAGAACATGGATATGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-356s1c1
Sequence:CCGGGCTACAGTTATTAGATGGCTTCTCGAGAAGCCATCTAATAACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1115s1c1
Sequence:CCGGGCCTGAGGTGAATCCATTGTACTCGAGTACAATGGATTCACCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1482s1c1
Sequence:CCGGCCAAACACATTACGCCACGTTCTCGAGAACGTGGCGTAATGTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-2204s1c1
Sequence:CCGGGCCATTGATAGATACCTCAAACTCGAGTTTGAGGTATCTATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173493
PASD1 MISSION shRNA shRNA Plasmid DNA
PAS domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173493.1-2846s1c1
Sequence:CCGGGCTTTGCATATCCATGTTCTACTCGAGTAGAACATGGATATGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-356s1c1
Sequence:CCGGGCTACAGTTATTAGATGGCTTCTCGAGAAGCCATCTAATAACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1115s1c1
Sequence:CCGGGCCTGAGGTGAATCCATTGTACTCGAGTACAATGGATTCACCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1482s1c1
Sequence:CCGGCCAAACACATTACGCCACGTTCTCGAGAACGTGGCGTAATGTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-2204s1c1
Sequence:CCGGGCCATTGATAGATACCTCAAACTCGAGTTTGAGGTATCTATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173493
PASD1 MISSION shRNA Lentiviral Transduction Particles
PAS domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173493.1-2846s1c1
Sequence:CCGGGCTTTGCATATCCATGTTCTACTCGAGTAGAACATGGATATGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-356s1c1
Sequence:CCGGGCTACAGTTATTAGATGGCTTCTCGAGAAGCCATCTAATAACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1115s1c1
Sequence:CCGGGCCTGAGGTGAATCCATTGTACTCGAGTACAATGGATTCACCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-1482s1c1
Sequence:CCGGCCAAACACATTACGCCACGTTCTCGAGAACGTGGCGTAATGTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173493.1-2204s1c1
Sequence:CCGGGCCATTGATAGATACCTCAAACTCGAGTTTGAGGTATCTATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)