EMAIL THIS PAGE TO A FRIEND

PASK

PAS domain containing serine/threonine kinase

68 Gene Product Result for
Synonyms: PASKIN STK37
Gene ID:
Human(23178) Summary: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(269224) PAS domain containing serine/threonine kinase
Rat(301617) PAS domain containing serine/threonine kinase
fruit fly(37824) PAS kinase
cow(512154) PAS domain containing serine/threonine kinase
Horse(100067612) PAS domain containing serine/threonine kinase
domestic cat(101096339) PAS domain containing serine/threonine kinase
dog(609502) PAS domain containing serine/threonine kinase
chicken(424845) PAS domain containing serine/threonine kinase
Zebrafish(322674) PAS domain containing serine/threonine kinase
sheep(101102694) PAS domain containing serine/threonine kinase
domestic guinea pig(100731396) PAS domain containing serine/threonine kinase
naked mole-rat(101712486) PAS domain containing serine/threonine kinase
Domestic Rabbit(100338542) PAS domain containing serine/threonine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015148 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015148 siRNAs that have been validated in the lab human pricing
NM_001009362 Rosetta Predictions rat pricing
NM_080850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015148 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145944 validated 1184
1 SASI_Hs01_00145943 validated 328
1 SASI_Hs01_00145945 validated 968
2 SASI_Hs01_00145946 predicted 286
3 SASI_Hs01_00145947 predicted 3315
4 SASI_Hs01_00145948 predicted 3839
5 SASI_Hs01_00145949 predicted 3441
6 SASI_Hs01_00145950 predicted 3270
7 SASI_Hs01_00145951 predicted 3524
8 SASI_Hs02_00347100 predicted 1557
9 SASI_Hs01_00145952 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042582 predicted 3703
2 SASI_Rn01_00042583 predicted 1521
3 SASI_Rn01_00042584 predicted 2038
4 SASI_Rn01_00042585 predicted 487
5 SASI_Rn01_00042586 predicted 1199
6 SASI_Rn02_00199520 predicted 2855
7 SASI_Rn02_00199521 predicted 1234
8 SASI_Rn01_00042587 predicted 2827
9 SASI_Rn01_00042589 predicted 1405
10 SASI_Rn01_00042590 predicted 3620
11 SASI_Rn01_00042588 predicted 2881
12 SASI_Rn01_00042591 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046274 predicted 3194
2 SASI_Mm01_00046275 predicted 2888
3 SASI_Mm02_00338223 predicted 1506
4 SASI_Mm01_00046277 predicted 1478
5 SASI_Mm01_00046278 predicted 1396
6 SASI_Mm01_00046279 predicted 2151
7 SASI_Mm01_00046280 predicted 1370
8 SASI_Mm01_00046281 predicted 2202
9 SASI_Mm02_00338224 predicted 2838
10 SASI_Mm01_00046282 predicted 1724
11 SASI_Mm01_00046276 predicted 2747
12 SASI_Mm01_00046283 predicted 3211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015148
VALIDATED
PASK MISSION shRNA Bacterial Glycerol Stock
PAS domain containing serine/threonine kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-1271s1c1
Sequence:CCGGCCTTGCGTACAACAGCTCATTCTCGAGAATGAGCTGTTGTACGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4207s1c1
Sequence:CCGGCAGAAGACAGTGATGCTGTATCTCGAGATACAGCATCACTGTCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-3275s1c1
Sequence:CCGGCGCCAATATCATCAAGGTATTCTCGAGAATACCTTGATGATATTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-905s1c1
Sequence:CCGGGCAGCATATCACAGACCTGATCTCGAGATCAGGTCTGTGATATGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1460s1c1
Sequence:CCGGGCTGATGGAAAGCCAAGACATCTCGAGATGTCTTGGCTTTCCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015148.2-2060s1c1
Sequence:CCGGGCTGCAGACCTGCTTGATTAACTCGAGTTAATCAAGCAGGTCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-844s1c1
Sequence:CCGGCGTCATGTGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCACATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-3353s1c1
Sequence:CCGGCCTAGACCTCTTCGCTTTCATCTCGAGATGAAAGCGAAGAGGTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4285s1c1
Sequence:CCGGCATTCCAGTGTTCAACTGTTTCTCGAGAAACAGTTGAACACTGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-2801s1c1
Sequence:CCGGCTTACGGCTGAGTATACAGTTCTCGAGAACTGTATACTCAGCCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1921s1c1
Sequence:CCGGGCCCTTGCTATGGGAGTGAATCTCGAGATTCACTCCCATAGCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015148.2-4178s21c1
Sequence:CCGGCTCATGTGCAGGTTTGATAAACTCGAGTTTATCAAACCTGCACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3854s21c1
Sequence:CCGGTGTGAATCTTGCTGACTATACCTCGAGGTATAGTCAGCAAGATTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3237s21c1
Sequence:CCGGGTTACTTTAGAGATCGCAATTCTCGAGAATTGCGATCTCTAAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015148
VALIDATED
PASK MISSION shRNA shRNA Plasmid DNA
PAS domain containing serine/threonine kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-1271s1c1
Sequence:CCGGCCTTGCGTACAACAGCTCATTCTCGAGAATGAGCTGTTGTACGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4207s1c1
Sequence:CCGGCAGAAGACAGTGATGCTGTATCTCGAGATACAGCATCACTGTCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-3275s1c1
Sequence:CCGGCGCCAATATCATCAAGGTATTCTCGAGAATACCTTGATGATATTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-905s1c1
Sequence:CCGGGCAGCATATCACAGACCTGATCTCGAGATCAGGTCTGTGATATGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1460s1c1
Sequence:CCGGGCTGATGGAAAGCCAAGACATCTCGAGATGTCTTGGCTTTCCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015148.2-2060s1c1
Sequence:CCGGGCTGCAGACCTGCTTGATTAACTCGAGTTAATCAAGCAGGTCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-844s1c1
Sequence:CCGGCGTCATGTGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCACATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-3353s1c1
Sequence:CCGGCCTAGACCTCTTCGCTTTCATCTCGAGATGAAAGCGAAGAGGTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4285s1c1
Sequence:CCGGCATTCCAGTGTTCAACTGTTTCTCGAGAAACAGTTGAACACTGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-2801s1c1
Sequence:CCGGCTTACGGCTGAGTATACAGTTCTCGAGAACTGTATACTCAGCCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1921s1c1
Sequence:CCGGGCCCTTGCTATGGGAGTGAATCTCGAGATTCACTCCCATAGCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015148.2-4178s21c1
Sequence:CCGGCTCATGTGCAGGTTTGATAAACTCGAGTTTATCAAACCTGCACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3854s21c1
Sequence:CCGGTGTGAATCTTGCTGACTATACCTCGAGGTATAGTCAGCAAGATTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3237s21c1
Sequence:CCGGGTTACTTTAGAGATCGCAATTCTCGAGAATTGCGATCTCTAAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015148
VALIDATED
PASK MISSION shRNA Lentiviral Transduction Particles
PAS domain containing serine/threonine kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-1271s1c1
Sequence:CCGGCCTTGCGTACAACAGCTCATTCTCGAGAATGAGCTGTTGTACGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4207s1c1
Sequence:CCGGCAGAAGACAGTGATGCTGTATCTCGAGATACAGCATCACTGTCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-3275s1c1
Sequence:CCGGCGCCAATATCATCAAGGTATTCTCGAGAATACCTTGATGATATTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-905s1c1
Sequence:CCGGGCAGCATATCACAGACCTGATCTCGAGATCAGGTCTGTGATATGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1460s1c1
Sequence:CCGGGCTGATGGAAAGCCAAGACATCTCGAGATGTCTTGGCTTTCCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015148.2-2060s1c1
Sequence:CCGGGCTGCAGACCTGCTTGATTAACTCGAGTTAATCAAGCAGGTCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015148.2-844s1c1
Sequence:CCGGCGTCATGTGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCACATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-3353s1c1
Sequence:CCGGCCTAGACCTCTTCGCTTTCATCTCGAGATGAAAGCGAAGAGGTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015148.2-4285s1c1
Sequence:CCGGCATTCCAGTGTTCAACTGTTTCTCGAGAAACAGTTGAACACTGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015148.2-2801s1c1
Sequence:CCGGCTTACGGCTGAGTATACAGTTCTCGAGAACTGTATACTCAGCCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015148.2-1921s1c1
Sequence:CCGGGCCCTTGCTATGGGAGTGAATCTCGAGATTCACTCCCATAGCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015148.2-4178s21c1
Sequence:CCGGCTCATGTGCAGGTTTGATAAACTCGAGTTTATCAAACCTGCACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3854s21c1
Sequence:CCGGTGTGAATCTTGCTGACTATACCTCGAGGTATAGTCAGCAAGATTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015148.2-3237s21c1
Sequence:CCGGGTTACTTTAGAGATCGCAATTCTCGAGAATTGCGATCTCTAAAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080850
PASK MISSION shRNA Bacterial Glycerol Stock
PAS domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3536s1c1
Sequence:CCGGGCGAGTTTCATCTTTCGACAACTCGAGTTGTCGAAAGATGAAACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1619s1c1
Sequence:CCGGCCAGTCCTTAAAGAACATTTACTCGAGTAAATGTTCTTTAAGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1165s1c1
Sequence:CCGGCCTGGGCAAGAATATCACTTTCTCGAGAAAGTGATATTCTTGCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-2696s1c1
Sequence:CCGGCGAGCAGAACTGTCTAACATTCTCGAGAATGTTAGACAGTTCTGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3734s1c1
Sequence:CCGGCCTGAGGTTCTCATTGGAAATCTCGAGATTTCCAATGAGAACCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-2191s21c1
Sequence:CCGGAGCAGTGTGGACACGTGTAATCTCGAGATTACACGTGTCCACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-1359s21c1
Sequence:CCGGGCTGCCAGATGGCACAATTTACTCGAGTAAATTGTGCCATCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-3464s21c1
Sequence:CCGGGTGAGGGCGAGTACGACTATACTCGAGTATAGTCGTACTCGCCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080850
PASK MISSION shRNA shRNA Plasmid DNA
PAS domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3536s1c1
Sequence:CCGGGCGAGTTTCATCTTTCGACAACTCGAGTTGTCGAAAGATGAAACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1619s1c1
Sequence:CCGGCCAGTCCTTAAAGAACATTTACTCGAGTAAATGTTCTTTAAGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1165s1c1
Sequence:CCGGCCTGGGCAAGAATATCACTTTCTCGAGAAAGTGATATTCTTGCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-2696s1c1
Sequence:CCGGCGAGCAGAACTGTCTAACATTCTCGAGAATGTTAGACAGTTCTGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3734s1c1
Sequence:CCGGCCTGAGGTTCTCATTGGAAATCTCGAGATTTCCAATGAGAACCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-2191s21c1
Sequence:CCGGAGCAGTGTGGACACGTGTAATCTCGAGATTACACGTGTCCACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-1359s21c1
Sequence:CCGGGCTGCCAGATGGCACAATTTACTCGAGTAAATTGTGCCATCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-3464s21c1
Sequence:CCGGGTGAGGGCGAGTACGACTATACTCGAGTATAGTCGTACTCGCCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080850
PASK MISSION shRNA Lentiviral Transduction Particles
PAS domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3536s1c1
Sequence:CCGGGCGAGTTTCATCTTTCGACAACTCGAGTTGTCGAAAGATGAAACTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1619s1c1
Sequence:CCGGCCAGTCCTTAAAGAACATTTACTCGAGTAAATGTTCTTTAAGGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-1165s1c1
Sequence:CCGGCCTGGGCAAGAATATCACTTTCTCGAGAAAGTGATATTCTTGCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-2696s1c1
Sequence:CCGGCGAGCAGAACTGTCTAACATTCTCGAGAATGTTAGACAGTTCTGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080850.1-3734s1c1
Sequence:CCGGCCTGAGGTTCTCATTGGAAATCTCGAGATTTCCAATGAGAACCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-2191s21c1
Sequence:CCGGAGCAGTGTGGACACGTGTAATCTCGAGATTACACGTGTCCACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-1359s21c1
Sequence:CCGGGCTGCCAGATGGCACAATTTACTCGAGTAAATTGTGCCATCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080850.2-3464s21c1
Sequence:CCGGGTGAGGGCGAGTACGACTATACTCGAGTATAGTCGTACTCGCCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)