EMAIL THIS PAGE TO A FRIEND

PATE1

prostate and testis expressed 1

83 Gene Product Result for
Synonyms: PATE
UniProtKB ID: Q8WXA2, Q3KNX2
Gene ID:
Rat(100361657) prostate and testis expressed 1
domestic guinea pig(100718780) prostate and testis expressed 1
sheep(101112270) prostate and testis expressed 1
cow(100294908) prostate and testis expressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138294 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144741 MISSION® esiRNA esiRNA human PATE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138294 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117778 predicted 230
2 SASI_Hs01_00117779 predicted 258
3 SASI_Hs01_00117780 predicted 261
4 SASI_Hs01_00117781 predicted 280
5 SASI_Hs01_00117782 predicted 375
6 SASI_Hs01_00117783 predicted 57
7 SASI_Hs01_00117787 predicted 311
8 SASI_Hs02_00363386 predicted 415
9 SASI_Hs02_00363387 predicted 314
10 SASI_Hs02_00363388 predicted 255
11 SASI_Hs01_00117784 predicted 296
12 SASI_Hs01_00117785 predicted 523
13 SASI_Hs01_00117786 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138294
PATE1 MISSION shRNA Bacterial Glycerol Stock
prostate and testis expressed 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-368s1c1
Sequence:CCGGCCTGTGCAATGAAGACCTTTACTCGAGTAAAGGTCTTCATTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-68s1c1
Sequence:CCGGTGGATCACTTTCAATGAGAAACTCGAGTTTCTCATTGAAAGTGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-288s1c1
Sequence:CCGGTGCCTAAAGAACTGTGCTGATCTCGAGATCAGCACAGTTCTTTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-93s1c1
Sequence:CCGGGCAGTCAATGAAATAGTTGCTCTCGAGAGCAACTATTTCATTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-196s1c1
Sequence:CCGGGAAGAGGAATATGCACAGCAACTCGAGTTGCTGTGCATATTCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138294
PATE1 MISSION shRNA shRNA Plasmid DNA
prostate and testis expressed 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-368s1c1
Sequence:CCGGCCTGTGCAATGAAGACCTTTACTCGAGTAAAGGTCTTCATTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-68s1c1
Sequence:CCGGTGGATCACTTTCAATGAGAAACTCGAGTTTCTCATTGAAAGTGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-288s1c1
Sequence:CCGGTGCCTAAAGAACTGTGCTGATCTCGAGATCAGCACAGTTCTTTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-93s1c1
Sequence:CCGGGCAGTCAATGAAATAGTTGCTCTCGAGAGCAACTATTTCATTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-196s1c1
Sequence:CCGGGAAGAGGAATATGCACAGCAACTCGAGTTGCTGTGCATATTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138294
PATE1 MISSION shRNA Lentiviral Transduction Particles
prostate and testis expressed 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-368s1c1
Sequence:CCGGCCTGTGCAATGAAGACCTTTACTCGAGTAAAGGTCTTCATTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-68s1c1
Sequence:CCGGTGGATCACTTTCAATGAGAAACTCGAGTTTCTCATTGAAAGTGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-288s1c1
Sequence:CCGGTGCCTAAAGAACTGTGCTGATCTCGAGATCAGCACAGTTCTTTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-93s1c1
Sequence:CCGGGCAGTCAATGAAATAGTTGCTCTCGAGAGCAACTATTTCATTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138294.1-196s1c1
Sequence:CCGGGAAGAGGAATATGCACAGCAACTCGAGTTGCTGTGCATATTCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)