EMAIL THIS PAGE TO A FRIEND

PATL1

protein associated with topoisomerase II homolog 1 (yeast)

172 Gene Product Result for
Synonyms: Pat1b hPat1b
UniProtKB ID: Q86TB9, B3KXT9, Q2TA86, Q6P166, Q8N9M6, Q8NI63
Gene ID:
Mouse(225929) protein associated with topoisomerase II homolog 1 (yeast)
Rat(361736) protein associated with topoisomerase II homolog 1 (yeast)
Thale Cress(843546) patellin-1
dog(609696) protein associated with topoisomerase II homolog 1 (yeast)
cow(537453) protein associated with topoisomerase II homolog 1 (yeast)
domestic cat(101100507) protein associated with topoisomerase II homolog 1 (yeast)
Zebrafish(100009659) protein associated with topoisomerase II homolog 1 (yeast)
domestic guinea pig(100712714) protein associated with topoisomerase II homolog 1 (yeast)
Domestic Rabbit(100355434) protein associated with topoisomerase II homolog 1 (yeast)
naked mole-rat(101707355) protein associated with topoisomerase II homolog 1 (yeast)
sheep(101112673) protein associated with topoisomerase II homolog 1 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152716 Rosetta Predictions human pricing
NM_001108520 Rosetta Predictions rat pricing
NM_172635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366613 predicted 1247
2 SASI_Hs02_00366614 predicted 1595
3 SASI_Hs01_00211159 predicted 706
4 SASI_Hs01_00211160 predicted 272
5 SASI_Hs01_00211162 predicted 1972
6 SASI_Hs02_00366615 predicted 1269
7 SASI_Hs02_00366616 predicted 1554
8 SASI_Hs01_00211163 predicted 1054
9 SASI_Hs02_00366617 predicted 1439
10 SASI_Hs02_00366618 predicted 1384
11 SASI_Hs01_00211156 predicted 316
12 SASI_Hs01_00211157 predicted 1751
13 SASI_Hs01_00211158 predicted 1870
14 SASI_Hs01_00211161 predicted 908
15 SASI_Hs01_00211164 predicted 539
16 SASI_Hs01_00211165 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239459 predicted 1227
2 SASI_Rn02_00239460 predicted 652
3 SASI_Rn02_00239461 predicted 1878
4 SASI_Rn02_00239462 predicted 1514
5 SASI_Rn02_00239463 predicted 1158
6 SASI_Rn02_00239464 predicted 1297
7 SASI_Rn02_00239465 predicted 1219
8 SASI_Rn02_00239466 predicted 1683
9 SASI_Rn02_00239467 predicted 313
10 SASI_Rn02_00239468 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074543 predicted 431
2 SASI_Mm01_00074544 predicted 1904
3 SASI_Mm01_00074545 predicted 677
4 SASI_Mm01_00074546 predicted 1184
5 SASI_Mm02_00344341 predicted 1318
6 SASI_Mm01_00074547 predicted 1525
7 SASI_Mm02_00344342 predicted 1251
8 SASI_Mm01_00074549 predicted 1610
9 SASI_Mm01_00074550 predicted 1232
10 SASI_Mm01_00074551 predicted 1003
11 SASI_Mm01_00074542 predicted 2337
12 SASI_Mm01_00074548 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152716
VALIDATED
PATL1 MISSION shRNA Bacterial Glycerol Stock
protein associated with topoisomerase II homolog 1 (yeast)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-2389s21c1
Sequence:CCGGGCTATGTTGACCGGCAGAAACCTCGAGGTTTCTGCCGGTCAACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1544s21c1
Sequence:CCGGCAAACTGGAGCACGCCTATAACTCGAGTTATAGGCGTGCTCCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1599s21c1
Sequence:CCGGACCGTTTCTAGTGTGAATAATCTCGAGATTATTCACACTAGAAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-169s1c1
Sequence:CCGGCATTACCAAGGCGGTCAACTTCTCGAGAAGTTGACCGCCTTGGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1855s1c1
Sequence:CCGGCCAAGCCAATCTCTATACCTACTCGAGTAGGTATAGAGATTGGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1263s1c1
Sequence:CCGGGAGGACTATGAAAGACGTTATCTCGAGATAACGTCTTTCATAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1515s1c1
Sequence:CCGGCCTTTCCTTATCAAGAAGGATCTCGAGATCCTTCTTGATAAGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-696s1c1
Sequence:CCGGCCAATGTTTAGACCGGACACACTCGAGTGTGTCCGGTCTAAACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152716.1-2019s1c1
Sequence:CCGGGCCATCACCAATGGAGTGTTTCTCGAGAAACACTCCATTGGTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1686s1c1
Sequence:CCGGGCTGTGCTCCAGAACAAGTTTCTCGAGAAACTTGTTCTGGAGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-153s1c1
Sequence:CCGGGACCTTTCTGAACGAGCATTACTCGAGTAATGCTCGTTCAGAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1264s21c1
Sequence:CCGGGTCAGCATCGGAATCTCAATGCTCGAGCATTGAGATTCCGATGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1326s21c1
Sequence:CCCGCATCTCCGAAAGGATCCATATCTCGAGATATGGATCCTTTCGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152716.2-2866s21c1
Sequence:CCGGACTATAGAAGAGCCAATTAAGCTCGAGCTTAATTGGCTCTTCTATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152716
VALIDATED
PATL1 MISSION shRNA shRNA Plasmid DNA
protein associated with topoisomerase II homolog 1 (yeast)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-2389s21c1
Sequence:CCGGGCTATGTTGACCGGCAGAAACCTCGAGGTTTCTGCCGGTCAACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1544s21c1
Sequence:CCGGCAAACTGGAGCACGCCTATAACTCGAGTTATAGGCGTGCTCCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1599s21c1
Sequence:CCGGACCGTTTCTAGTGTGAATAATCTCGAGATTATTCACACTAGAAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-169s1c1
Sequence:CCGGCATTACCAAGGCGGTCAACTTCTCGAGAAGTTGACCGCCTTGGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1855s1c1
Sequence:CCGGCCAAGCCAATCTCTATACCTACTCGAGTAGGTATAGAGATTGGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1263s1c1
Sequence:CCGGGAGGACTATGAAAGACGTTATCTCGAGATAACGTCTTTCATAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1515s1c1
Sequence:CCGGCCTTTCCTTATCAAGAAGGATCTCGAGATCCTTCTTGATAAGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-696s1c1
Sequence:CCGGCCAATGTTTAGACCGGACACACTCGAGTGTGTCCGGTCTAAACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152716.1-2019s1c1
Sequence:CCGGGCCATCACCAATGGAGTGTTTCTCGAGAAACACTCCATTGGTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1686s1c1
Sequence:CCGGGCTGTGCTCCAGAACAAGTTTCTCGAGAAACTTGTTCTGGAGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-153s1c1
Sequence:CCGGGACCTTTCTGAACGAGCATTACTCGAGTAATGCTCGTTCAGAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1264s21c1
Sequence:CCGGGTCAGCATCGGAATCTCAATGCTCGAGCATTGAGATTCCGATGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1326s21c1
Sequence:CCCGCATCTCCGAAAGGATCCATATCTCGAGATATGGATCCTTTCGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152716.2-2866s21c1
Sequence:CCGGACTATAGAAGAGCCAATTAAGCTCGAGCTTAATTGGCTCTTCTATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152716
VALIDATED
PATL1 MISSION shRNA Lentiviral Transduction Particles
protein associated with topoisomerase II homolog 1 (yeast)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-2389s21c1
Sequence:CCGGGCTATGTTGACCGGCAGAAACCTCGAGGTTTCTGCCGGTCAACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1544s21c1
Sequence:CCGGCAAACTGGAGCACGCCTATAACTCGAGTTATAGGCGTGCTCCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1599s21c1
Sequence:CCGGACCGTTTCTAGTGTGAATAATCTCGAGATTATTCACACTAGAAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-169s1c1
Sequence:CCGGCATTACCAAGGCGGTCAACTTCTCGAGAAGTTGACCGCCTTGGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1855s1c1
Sequence:CCGGCCAAGCCAATCTCTATACCTACTCGAGTAGGTATAGAGATTGGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1263s1c1
Sequence:CCGGGAGGACTATGAAAGACGTTATCTCGAGATAACGTCTTTCATAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1515s1c1
Sequence:CCGGCCTTTCCTTATCAAGAAGGATCTCGAGATCCTTCTTGATAAGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152716.1-696s1c1
Sequence:CCGGCCAATGTTTAGACCGGACACACTCGAGTGTGTCCGGTCTAAACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152716.1-2019s1c1
Sequence:CCGGGCCATCACCAATGGAGTGTTTCTCGAGAAACACTCCATTGGTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-1686s1c1
Sequence:CCGGGCTGTGCTCCAGAACAAGTTTCTCGAGAAACTTGTTCTGGAGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152716.1-153s1c1
Sequence:CCGGGACCTTTCTGAACGAGCATTACTCGAGTAATGCTCGTTCAGAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1264s21c1
Sequence:CCGGGTCAGCATCGGAATCTCAATGCTCGAGCATTGAGATTCCGATGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152716.2-1326s21c1
Sequence:CCCGCATCTCCGAAAGGATCCATATCTCGAGATATGGATCCTTTCGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152716.2-2866s21c1
Sequence:CCGGACTATAGAAGAGCCAATTAAGCTCGAGCTTAATTGGCTCTTCTATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172635
VALIDATED
PATL1 MISSION shRNA Bacterial Glycerol Stock
protein associated with topoisomerase II homolog 1 (yeast)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.2-654s1c1
Sequence:CCGGGGTCAACATCACCTATCATTGCTCGAGCAATGATAGGTGATGTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3609s1c1
Sequence:CCGGCCTAGTGGTTACAGTTCTGAACTCGAGTTCAGAACTGTAACCACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-2334s1c1
Sequence:CCGGCCAATCTCTATCCCTACAAATCTCGAGATTTGTAGGGATAGAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-318s1c1
Sequence:CCGGGCTGATGAACAAACAGGCAATCTCGAGATTGCCTGTTTGTTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3162s1c1
Sequence:CCGGCCTTTGTTTCTGACAACCATACTCGAGTATGGTTGTCAGAAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-2165s1c1
Sequence:CCGGGCTCCAGAACAAGTTTGGCTTCTCGAGAAGCCAAACTTGTTCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-422s1c1
Sequence:CCGGGCTAGAAGATCCAGCTATCATCTCGAGATGATAGCTGGATCTTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172635
VALIDATED
PATL1 MISSION shRNA shRNA Plasmid DNA
protein associated with topoisomerase II homolog 1 (yeast)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.2-654s1c1
Sequence:CCGGGGTCAACATCACCTATCATTGCTCGAGCAATGATAGGTGATGTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3609s1c1
Sequence:CCGGCCTAGTGGTTACAGTTCTGAACTCGAGTTCAGAACTGTAACCACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-2334s1c1
Sequence:CCGGCCAATCTCTATCCCTACAAATCTCGAGATTTGTAGGGATAGAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-318s1c1
Sequence:CCGGGCTGATGAACAAACAGGCAATCTCGAGATTGCCTGTTTGTTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3162s1c1
Sequence:CCGGCCTTTGTTTCTGACAACCATACTCGAGTATGGTTGTCAGAAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-2165s1c1
Sequence:CCGGGCTCCAGAACAAGTTTGGCTTCTCGAGAAGCCAAACTTGTTCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-422s1c1
Sequence:CCGGGCTAGAAGATCCAGCTATCATCTCGAGATGATAGCTGGATCTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172635
VALIDATED
PATL1 MISSION shRNA Lentiviral Transduction Particles
protein associated with topoisomerase II homolog 1 (yeast)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.2-654s1c1
Sequence:CCGGGGTCAACATCACCTATCATTGCTCGAGCAATGATAGGTGATGTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3609s1c1
Sequence:CCGGCCTAGTGGTTACAGTTCTGAACTCGAGTTCAGAACTGTAACCACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-2334s1c1
Sequence:CCGGCCAATCTCTATCCCTACAAATCTCGAGATTTGTAGGGATAGAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-318s1c1
Sequence:CCGGGCTGATGAACAAACAGGCAATCTCGAGATTGCCTGTTTGTTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-3162s1c1
Sequence:CCGGCCTTTGTTTCTGACAACCATACTCGAGTATGGTTGTCAGAAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172635.1-2165s1c1
Sequence:CCGGGCTCCAGAACAAGTTTGGCTTCTCGAGAAGCCAAACTTGTTCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172635.1-422s1c1
Sequence:CCGGGCTAGAAGATCCAGCTATCATCTCGAGATGATAGCTGGATCTTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)