EMAIL THIS PAGE TO A FRIEND

PATL2

protein associated with topoisomerase II homolog 2 (yeast)

82 Gene Product Result for
Synonyms: Pat1a hPat1a
UniProtKB ID: C9JE40
Gene ID:
Mouse(67578) protein associated with topoisomerase II homolog 2 (yeast)
Rat(366176) protein associated with topoisomerase II homolog 2 (yeast)
sheep(101116735) protein associated with topoisomerase II homolog 2 (yeast)
naked mole-rat(101702143) protein associated with topoisomerase II homolog 2 (yeast)
Domestic Rabbit(100356903) protein associated with topoisomerase II homolog 2 (yeast)
domestic guinea pig(100720084) protein associated with topoisomerase II homolog 2 (yeast)
Thale Cress(838859) patellin 2
cow(616745) protein associated with topoisomerase II homolog 2 (yeast)
Horse(100070621) protein associated with topoisomerase II homolog 2 (yeast)
chicken(415327) protein associated with topoisomerase II homolog 2 (yeast)
dog(609145) protein associated with topoisomerase II homolog 2 (yeast)
domestic cat(101095103) protein associated with topoisomerase II homolog 2 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301042 ANTI-PATL2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_113825 Rosetta Predictions human pricing
XM_929516 Rosetta Predictions human pricing
XM_933726 Rosetta Predictions human pricing
XM_933733 Rosetta Predictions human pricing
XR_015477 Rosetta Predictions human pricing
XR_040923 Rosetta Predictions human pricing
XM_345426 Rosetta Predictions rat pricing
NM_026251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_113825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297242 predicted 1303
2 SASI_Hs01_00297243 predicted 1362
3 SASI_Hs01_00297244 predicted 1618
4 SASI_Hs01_00297245 predicted 1221
5 SASI_Hs01_00297246 predicted 1477
6 SASI_Hs01_00297247 predicted 885
7 SASI_Hs01_00297248 predicted 655
8 SASI_Hs01_00297249 predicted 1256
9 SASI_Hs01_00297250 predicted 929
10 SASI_Hs01_00297251 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265794 predicted 1345
2 SASI_Hs01_00265795 predicted 1411
3 SASI_Hs01_00265796 predicted 1670
4 SASI_Hs01_00265797 predicted 1272
5 SASI_Hs01_00265798 predicted 1515
6 SASI_Hs01_00265799 predicted 932
7 SASI_Hs01_00265800 predicted 698
8 SASI_Hs01_00265801 predicted 1310
9 SASI_Hs01_00265802 predicted 1545
10 SASI_Hs01_00265803 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249757 predicted 318
2 SASI_Hs01_00249758 predicted 315
3 SASI_Hs01_00249759 predicted 334
4 SASI_Hs01_00249760 predicted 319
5 SASI_Hs01_00249761 predicted 306
6 SASI_Hs01_00249762 predicted 315
7 SASI_Hs01_00249763 predicted 264
8 SASI_Hs01_00249764 predicted 301
9 SASI_Hs01_00249765 predicted 324
10 SASI_Hs01_00249766 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257571 predicted 1426
2 SASI_Hs01_00257572 predicted 1354
3 SASI_Hs01_00257573 predicted 1564
4 SASI_Hs01_00257574 predicted 1581
5 SASI_Hs01_00257575 predicted 1267
6 SASI_Hs01_00257576 predicted 932
7 SASI_Hs01_00257577 predicted 701
8 SASI_Hs01_00257578 predicted 1308
9 SASI_Hs01_00257579 predicted 980
10 SASI_Hs01_00257580 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488255 predicted 1531
2 SASI_Hs02_00488256 predicted 1368
3 SASI_Hs02_00488257 predicted 1432
4 SASI_Hs02_00488258 predicted 1288
5 SASI_Hs02_00488259 predicted 949
6 SASI_Hs02_00488260 predicted 1377
7 SASI_Hs02_00488261 predicted 1325
8 SASI_Hs02_00488262 predicted 1003
9 SASI_Hs02_00488263 predicted 573
10 SASI_Hs02_00488264 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523128 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140786 predicted 1216
2 SASI_Rn01_00140787 predicted 1034
3 SASI_Rn01_00140788 predicted 739
4 SASI_Rn01_00140789 predicted 1155
5 SASI_Rn01_00140790 predicted 898
6 SASI_Rn01_00140791 predicted 1229
7 SASI_Rn01_00140792 predicted 920
8 SASI_Rn01_00140793 predicted 1160
9 SASI_Rn01_00140794 predicted 745
10 SASI_Rn01_00140795 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024318 predicted 1547
2 SASI_Mm01_00024320 predicted 2085
3 SASI_Mm01_00024321 predicted 1706
4 SASI_Mm01_00024322 predicted 2097
5 SASI_Mm01_00024323 predicted 2091
6 SASI_Mm01_00024324 predicted 1841
7 SASI_Mm02_00329936 predicted 2116
8 SASI_Mm02_00329937 predicted 1771
9 SASI_Mm01_00024325 predicted 1034
10 SASI_Mm01_00024326 predicted 1639
11 SASI_Mm01_00024319 predicted 1068
12 SASI_Mm01_00024327 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145112
PATL2 MISSION shRNA Bacterial Glycerol Stock
protein associated with topoisomerase II homolog 2 (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145112.1-1776s21c1
Sequence:CCGGACACTAGCTACATAGACTATGCTCGAGCATAGTCTATGTAGCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-795s21c1
Sequence:CCGGGAGCTACTTGGACGAAGAAACCTCGAGGTTTCTTCGTCCAAGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-1313s21c1
Sequence:CCGGGGCTGATCAGGCCCTACAAATCTCGAGATTTGTAGGGCCTGATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-993s21c1
Sequence:CCGGAGTCAGAGGCTTCGGGTATTACTCGAGTAATACCCGAAGCCTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-730s21c1
Sequence:CCGGCCCGCCTGGATGACTACTATTCTCGAGAATAGTAGTCATCCAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145112
PATL2 MISSION shRNA shRNA Plasmid DNA
protein associated with topoisomerase II homolog 2 (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145112.1-1776s21c1
Sequence:CCGGACACTAGCTACATAGACTATGCTCGAGCATAGTCTATGTAGCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-795s21c1
Sequence:CCGGGAGCTACTTGGACGAAGAAACCTCGAGGTTTCTTCGTCCAAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-1313s21c1
Sequence:CCGGGGCTGATCAGGCCCTACAAATCTCGAGATTTGTAGGGCCTGATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-993s21c1
Sequence:CCGGAGTCAGAGGCTTCGGGTATTACTCGAGTAATACCCGAAGCCTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-730s21c1
Sequence:CCGGCCCGCCTGGATGACTACTATTCTCGAGAATAGTAGTCATCCAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145112
PATL2 MISSION shRNA Lentiviral Transduction Particles
protein associated with topoisomerase II homolog 2 (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145112.1-1776s21c1
Sequence:CCGGACACTAGCTACATAGACTATGCTCGAGCATAGTCTATGTAGCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-795s21c1
Sequence:CCGGGAGCTACTTGGACGAAGAAACCTCGAGGTTTCTTCGTCCAAGTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-1313s21c1
Sequence:CCGGGGCTGATCAGGCCCTACAAATCTCGAGATTTGTAGGGCCTGATCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-993s21c1
Sequence:CCGGAGTCAGAGGCTTCGGGTATTACTCGAGTAATACCCGAAGCCTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145112.1-730s21c1
Sequence:CCGGCCCGCCTGGATGACTACTATTCTCGAGAATAGTAGTCATCCAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026251
PATL2 MISSION shRNA Bacterial Glycerol Stock
protein associated with topoisomerase II homolog 2 (yeast)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1125s1c1
Sequence:CCGGGATGATTACTACTACCAGAAACTCGAGTTTCTGGTAGTAGTAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2137s1c1
Sequence:CCGGGCTGAAATATCAGAAACGGAACTCGAGTTCCGTTTCTGATATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2188s1c1
Sequence:CCGGGCCATTTCCTATACTTTGTTACTCGAGTAACAAAGTATAGGAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1842s1c1
Sequence:CCGGCTTCAGAATCAGTTTGGGATACTCGAGTATCCCAAACTGATTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1205s1c1
Sequence:CCGGCAGGGTTGAGTTTCTCCAGTTCTCGAGAACTGGAGAAACTCAACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-597s1c1
Sequence:CCGGGATGAATGTGTGTGTTCAGATCTCGAGATCTGAACACACACATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026251
PATL2 MISSION shRNA shRNA Plasmid DNA
protein associated with topoisomerase II homolog 2 (yeast)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1125s1c1
Sequence:CCGGGATGATTACTACTACCAGAAACTCGAGTTTCTGGTAGTAGTAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2137s1c1
Sequence:CCGGGCTGAAATATCAGAAACGGAACTCGAGTTCCGTTTCTGATATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2188s1c1
Sequence:CCGGGCCATTTCCTATACTTTGTTACTCGAGTAACAAAGTATAGGAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1842s1c1
Sequence:CCGGCTTCAGAATCAGTTTGGGATACTCGAGTATCCCAAACTGATTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1205s1c1
Sequence:CCGGCAGGGTTGAGTTTCTCCAGTTCTCGAGAACTGGAGAAACTCAACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-597s1c1
Sequence:CCGGGATGAATGTGTGTGTTCAGATCTCGAGATCTGAACACACACATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026251
PATL2 MISSION shRNA Lentiviral Transduction Particles
protein associated with topoisomerase II homolog 2 (yeast)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1125s1c1
Sequence:CCGGGATGATTACTACTACCAGAAACTCGAGTTTCTGGTAGTAGTAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2137s1c1
Sequence:CCGGGCTGAAATATCAGAAACGGAACTCGAGTTCCGTTTCTGATATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026251.1-2188s1c1
Sequence:CCGGGCCATTTCCTATACTTTGTTACTCGAGTAACAAAGTATAGGAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1842s1c1
Sequence:CCGGCTTCAGAATCAGTTTGGGATACTCGAGTATCCCAAACTGATTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-1205s1c1
Sequence:CCGGCAGGGTTGAGTTTCTCCAGTTCTCGAGAACTGGAGAAACTCAACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026251.1-597s1c1
Sequence:CCGGGATGAATGTGTGTGTTCAGATCTCGAGATCTGAACACACACATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)