EMAIL THIS PAGE TO A FRIEND

PATZ1

POZ (BTB) and AT hook containing zinc finger 1

207 Gene Product Result for
Synonyms: MAZR PATZ RIAZ ZBTB19 ZNF278 ZSG dJ400N23
UniProtKB ID: Q9HBE1, Q9HBE2, Q9HBE3, Q9P1A9, Q9UDU0, Q9Y529
Gene ID:
Human(23598) Summary: The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
Mouse(56218) POZ (BTB) and AT hook containing zinc finger 1
Rat(305471) POZ (BTB) and AT hook containing zinc finger 1
Zebrafish(560290) POZ (BTB) and AT hook containing zinc finger 1
domestic cat(101097426) POZ (BTB) and AT hook containing zinc finger 1
cow(532416) POZ (BTB) and AT hook containing zinc finger 1
Horse(100058375) POZ (BTB) and AT hook containing zinc finger 1
dog(486365) POZ (BTB) and AT hook containing zinc finger 1
chicken(416963) POZ (BTB) and AT hook containing zinc finger 1
domestic guinea pig(100730234) POZ (BTB) and AT hook containing zinc finger 1
Domestic Rabbit(100328729) POZ (BTB) and AT hook containing zinc finger 1
naked mole-rat(101699786) POZ (BTB) and AT hook containing zinc finger 1
sheep(101115906) POZ (BTB) and AT hook containing zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014323 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061981 MISSION® esiRNA esiRNA targeting mouse Patz1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014323 Rosetta Predictions human pricing
NM_032050 Rosetta Predictions human pricing
NM_032051 Rosetta Predictions human pricing
NM_032052 Rosetta Predictions human pricing
NM_001107231 Rosetta Predictions rat pricing
NM_019574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140417 predicted 1727
2 SASI_Hs01_00140418 predicted 1535
3 SASI_Hs01_00140419 predicted 1709
4 SASI_Hs01_00140420 predicted 840
5 SASI_Hs01_00140421 predicted 1736
6 SASI_Hs01_00140423 predicted 1080
7 SASI_Hs01_00140424 predicted 1238
8 SASI_Hs01_00140425 predicted 702
9 SASI_Hs01_00140426 predicted 1745
10 SASI_Hs02_00345438 predicted 1029
11 SASI_Hs01_00140422 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078900 predicted 1719
2 SASI_Hs01_00078901 predicted 1542
3 SASI_Hs01_00078902 predicted 1706
4 SASI_Hs01_00078903 predicted 845
5 SASI_Hs01_00078904 predicted 1740
6 SASI_Hs01_00078906 predicted 1080
7 SASI_Hs01_00078907 predicted 1244
8 SASI_Hs01_00078908 predicted 700
9 SASI_Hs01_00078909 predicted 1749
10 SASI_Hs02_00359251 predicted 1030
11 SASI_Hs01_00078905 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025637 predicted 1719
2 SASI_Hs01_00025638 predicted 1538
3 SASI_Hs01_00025639 predicted 1706
4 SASI_Hs01_00025640 predicted 846
5 SASI_Hs01_00025641 predicted 1734
6 SASI_Hs01_00025643 predicted 1078
7 SASI_Hs01_00025644 predicted 1246
8 SASI_Hs01_00025645 predicted 705
9 SASI_Hs01_00025646 predicted 1745
10 SASI_Hs02_00359252 predicted 1028
11 SASI_Hs01_00025642 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149710 predicted 1722
2 SASI_Hs01_00149711 predicted 1544
3 SASI_Hs01_00149712 predicted 1714
4 SASI_Hs01_00149713 predicted 847
5 SASI_Hs01_00149714 predicted 1738
6 SASI_Hs01_00149716 predicted 1087
7 SASI_Hs01_00149717 predicted 1246
8 SASI_Hs01_00149718 predicted 702
9 SASI_Hs01_00149719 predicted 1746
10 SASI_Hs02_00359253 predicted 1027
11 SASI_Hs01_00149715 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226805 predicted 1355
2 SASI_Rn02_00226806 predicted 651
3 SASI_Rn02_00226807 predicted 1549
4 SASI_Rn02_00226808 predicted 1343
5 SASI_Rn02_00226809 predicted 1767
6 SASI_Rn02_00226810 predicted 1804
7 SASI_Rn02_00226811 predicted 1958
8 SASI_Rn02_00226812 predicted 1012
9 SASI_Rn02_00226813 predicted 1270
10 SASI_Rn02_00226814 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081917 predicted 671
2 SASI_Mm01_00081918 predicted 895
3 SASI_Mm01_00081919 predicted 1230
4 SASI_Mm01_00081920 predicted 485
5 SASI_Mm01_00081921 predicted 2145
6 SASI_Mm01_00081922 predicted 810
7 SASI_Mm01_00081923 predicted 525
8 SASI_Mm01_00081925 predicted 1365
9 SASI_Mm01_00081926 predicted 2153
10 SASI_Mm02_00324630 predicted 2119
11 SASI_Mm01_00081924 predicted 1452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019574
VALIDATED
PATZ1 MISSION shRNA Bacterial Glycerol Stock
POZ (BTB) and AT hook containing zinc finger 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019574.1-2371s1c1
Sequence:CCGGGCCAGAATTTCTGGTGCTCAACTCGAGTTGAGCACCAGAAATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1430s1c1
Sequence:CCGGCCAGATCACTTGAATGGACATCTCGAGATGTCCATTCAAGTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1861s1c1
Sequence:CCGGCCGTTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019574.1-514s1c1
Sequence:CCGGCTTCGCTTATACGTCCCGAATCTCGAGATTCGGGACGTATAAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-743s1c1
Sequence:CCGGGCAGCCAACAGTAACGGTATTCTCGAGAATACCGTTACTGTTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-2015s21c1
Sequence:CCGGTCAGCGTTTGCATCATCTTTACTCGAGTAAAGATGATGCAAACGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019574.2-2264s21c1
Sequence:CCGGCTGATACTCTCTGTAGAAATACTCGAGTATTTCTACAGAGAGTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-505s21c1
Sequence:CCGGCATCCTGGACTTCGCTTATACCTCGAGGTATAAGCGAAGTCCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-1240s21c1
Sequence:CCGGCAAGATCTTTCGTGACGTATACTCGAGTATACGTCACGAAAGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1107s21c1
Sequence:CCGGCAAGCCTCCAGTTGGGCTATACTCGAGTATAGCCCAACTGGAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1656s21c1
Sequence:CCGGGTAACCGAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTCGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019574
VALIDATED
PATZ1 MISSION shRNA shRNA Plasmid DNA
POZ (BTB) and AT hook containing zinc finger 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019574.1-2371s1c1
Sequence:CCGGGCCAGAATTTCTGGTGCTCAACTCGAGTTGAGCACCAGAAATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1430s1c1
Sequence:CCGGCCAGATCACTTGAATGGACATCTCGAGATGTCCATTCAAGTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1861s1c1
Sequence:CCGGCCGTTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019574.1-514s1c1
Sequence:CCGGCTTCGCTTATACGTCCCGAATCTCGAGATTCGGGACGTATAAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-743s1c1
Sequence:CCGGGCAGCCAACAGTAACGGTATTCTCGAGAATACCGTTACTGTTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-2015s21c1
Sequence:CCGGTCAGCGTTTGCATCATCTTTACTCGAGTAAAGATGATGCAAACGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019574.2-2264s21c1
Sequence:CCGGCTGATACTCTCTGTAGAAATACTCGAGTATTTCTACAGAGAGTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-505s21c1
Sequence:CCGGCATCCTGGACTTCGCTTATACCTCGAGGTATAAGCGAAGTCCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-1240s21c1
Sequence:CCGGCAAGATCTTTCGTGACGTATACTCGAGTATACGTCACGAAAGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1107s21c1
Sequence:CCGGCAAGCCTCCAGTTGGGCTATACTCGAGTATAGCCCAACTGGAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1656s21c1
Sequence:CCGGGTAACCGAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTCGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019574
VALIDATED
PATZ1 MISSION shRNA Lentiviral Transduction Particles
POZ (BTB) and AT hook containing zinc finger 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019574.1-2371s1c1
Sequence:CCGGGCCAGAATTTCTGGTGCTCAACTCGAGTTGAGCACCAGAAATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1430s1c1
Sequence:CCGGCCAGATCACTTGAATGGACATCTCGAGATGTCCATTCAAGTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-1861s1c1
Sequence:CCGGCCGTTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019574.1-514s1c1
Sequence:CCGGCTTCGCTTATACGTCCCGAATCTCGAGATTCGGGACGTATAAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019574.1-743s1c1
Sequence:CCGGGCAGCCAACAGTAACGGTATTCTCGAGAATACCGTTACTGTTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-2015s21c1
Sequence:CCGGTCAGCGTTTGCATCATCTTTACTCGAGTAAAGATGATGCAAACGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019574.2-2264s21c1
Sequence:CCGGCTGATACTCTCTGTAGAAATACTCGAGTATTTCTACAGAGAGTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-505s21c1
Sequence:CCGGCATCCTGGACTTCGCTTATACCTCGAGGTATAAGCGAAGTCCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019574.2-1240s21c1
Sequence:CCGGCAAGATCTTTCGTGACGTATACTCGAGTATACGTCACGAAAGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1107s21c1
Sequence:CCGGCAAGCCTCCAGTTGGGCTATACTCGAGTATAGCCCAACTGGAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019574.2-1656s21c1
Sequence:CCGGGTAACCGAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTCGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014323
VALIDATED
PATZ1 MISSION shRNA Bacterial Glycerol Stock
POZ (BTB) and AT hook containing zinc finger 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-2180s1c1
Sequence:CCGGGCCTCCTACTTAAAGGTCCATCTCGAGATGGACCTTTAAGTAGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-850s1c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-1124s1c1
Sequence:CCGGGTCATCAAACAGTCCAACGTACTCGAGTACGTTGGACTGTTTGATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2503s1c1
Sequence:CCGGCCGCTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2298s1c1
Sequence:CCGGGCAACAAAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTTTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-1936s21c1
Sequence:CCGGTGATCACTTGAACGGACATATCTCGAGATATGTCCGTTCAAGTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-2646s21c1
Sequence:CCGGAGATTGTTCAGTCGGCATTTGCTCGAGCAAATGCCGACTGAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-850s21c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014323.2-3161s21c1
Sequence:CCGGCTAGGGTCTCCACCTACTTATCTCGAGATAAGTAGGTGGAGACCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-983s21c1
Sequence:CCGGACTATCAGCTCCAAGGTATTTCTCGAGAAATACCTTGGAGCTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014323
VALIDATED
PATZ1 MISSION shRNA shRNA Plasmid DNA
POZ (BTB) and AT hook containing zinc finger 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-2180s1c1
Sequence:CCGGGCCTCCTACTTAAAGGTCCATCTCGAGATGGACCTTTAAGTAGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-850s1c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-1124s1c1
Sequence:CCGGGTCATCAAACAGTCCAACGTACTCGAGTACGTTGGACTGTTTGATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2503s1c1
Sequence:CCGGCCGCTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2298s1c1
Sequence:CCGGGCAACAAAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTTTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-1936s21c1
Sequence:CCGGTGATCACTTGAACGGACATATCTCGAGATATGTCCGTTCAAGTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-2646s21c1
Sequence:CCGGAGATTGTTCAGTCGGCATTTGCTCGAGCAAATGCCGACTGAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-850s21c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014323.2-3161s21c1
Sequence:CCGGCTAGGGTCTCCACCTACTTATCTCGAGATAAGTAGGTGGAGACCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-983s21c1
Sequence:CCGGACTATCAGCTCCAAGGTATTTCTCGAGAAATACCTTGGAGCTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014323
VALIDATED
PATZ1 MISSION shRNA Lentiviral Transduction Particles
POZ (BTB) and AT hook containing zinc finger 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-2180s1c1
Sequence:CCGGGCCTCCTACTTAAAGGTCCATCTCGAGATGGACCTTTAAGTAGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-850s1c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014323.2-1124s1c1
Sequence:CCGGGTCATCAAACAGTCCAACGTACTCGAGTACGTTGGACTGTTTGATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2503s1c1
Sequence:CCGGCCGCTCTAAGTCCTACTTGAACTCGAGTTCAAGTAGGACTTAGAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014323.2-2298s1c1
Sequence:CCGGGCAACAAAGAAGGCCAGAAATCTCGAGATTTCTGGCCTTCTTTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-1936s21c1
Sequence:CCGGTGATCACTTGAACGGACATATCTCGAGATATGTCCGTTCAAGTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-2646s21c1
Sequence:CCGGAGATTGTTCAGTCGGCATTTGCTCGAGCAAATGCCGACTGAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014323.2-850s21c1
Sequence:CCGGCGAGTACTTTGAGTCGGTGTTCTCGAGAACACCGACTCAAAGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014323.2-3161s21c1
Sequence:CCGGCTAGGGTCTCCACCTACTTATCTCGAGATAAGTAGGTGGAGACCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014323.2-983s21c1
Sequence:CCGGACTATCAGCTCCAAGGTATTTCTCGAGAAATACCTTGGAGCTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)