EMAIL THIS PAGE TO A FRIEND

PAWR

PRKC, apoptosis, WT1, regulator

101 Gene Product Result for
Synonyms: PAR4 Par-4
UniProtKB ID: Q96IZ0, O75796, Q6FHY9, Q8N700
Gene ID:
Human(5074) Summary: The tumor suppressor WT1 represses and activates transcription. The protein encoded by this gene is a WT1-interacting protein that itself functions as a transcriptional repressor. It contains a putative leucine zipper domain which interacts with the zinc finger DNA binding domain of WT1. This protein is specifically upregulated during apoptosis of prostate cells. [provided by RefSeq, Jul 2008]
Mouse(114774) PRKC, apoptosis, WT1, regulator
Rat(64513) PRKC, apoptosis, WT1, regulator
Zebrafish(449994) PRKC, apoptosis, WT1, regulator
chicken(417870) PRKC, apoptosis, WT1, regulator
dog(611487) PRKC, apoptosis, WT1, regulator
cow(532789) PRKC, apoptosis, WT1, regulator
naked mole-rat(101700984) PRKC, apoptosis, WT1, regulator
domestic guinea pig(100736140) PRKC, apoptosis, WT1, regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002583 Rosetta Predictions human pricing
NM_033485 Rosetta Predictions rat pricing
NM_054056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086681 predicted 982
2 SASI_Hs01_00086682 predicted 1033
3 SASI_Hs01_00086683 predicted 866
4 SASI_Hs01_00086684 predicted 845
5 SASI_Hs01_00086685 predicted 916
6 SASI_Hs01_00086686 predicted 856
7 SASI_Hs01_00086688 predicted 1140
8 SASI_Hs01_00086689 predicted 878
9 SASI_Hs02_00334082 predicted 878
10 SASI_Hs01_00086680 predicted 1045
11 SASI_Hs01_00086687 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094310 predicted 770
2 SASI_Rn01_00094311 predicted 738
3 SASI_Rn01_00094312 predicted 1241
4 SASI_Rn01_00094313 predicted 1177
5 SASI_Rn01_00094314 predicted 957
6 SASI_Rn01_00094315 predicted 1136
7 SASI_Rn01_00094316 predicted 897
8 SASI_Rn01_00094317 predicted 1319
9 SASI_Rn02_00265568 predicted 1156
10 SASI_Rn01_00094318 predicted 1106
11 SASI_Rn01_00094319 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107178 predicted 933
2 SASI_Mm01_00107179 predicted 251
3 SASI_Mm01_00107180 predicted 861
4 SASI_Mm02_00337978 predicted 921
5 SASI_Mm02_00337979 predicted 1081
6 SASI_Mm02_00337980 predicted 1572
7 SASI_Mm01_00107182 predicted 550
8 SASI_Mm02_00337981 predicted 695
9 SASI_Mm02_00337982 predicted 1566
10 SASI_Mm01_00107183 predicted 547
11 SASI_Mm01_00107181 predicted 874
12 SASI_Mm01_00107184 predicted 904
13 SASI_Mm01_00107185 predicted 546
14 SASI_Mm01_00107186 predicted 790
15 SASI_Mm01_00107187 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054056
VALIDATED
PAWR MISSION shRNA Bacterial Glycerol Stock
PRKC, apoptosis, WT1, regulator
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1575s21c1
Sequence:CCGGTTGGCCTACAATGCCTTATTACTCGAGTAATAAGGCATTGTAGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-867s21c1
Sequence:CCGGAGAAGATGAAATCTCAAATAGCTCGAGCTATTTGAGATTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1499s21c1
Sequence:CCGGTATCTACGTTAGCCCATATTCCTCGAGGAATATGGGCTAACGTAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1036s21c1
Sequence:CCGGGTGAGGCTGATGCAAGATAAACTCGAGTTTATCTTGCATCAGCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-826s21c1
Sequence:CCGGAGAACAGTTCCAGGCAGATACCTCGAGGTATCTGCCTGGAACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1074s21c1
Sequence:CCGGACTCAAGGAAGAGATCGATTTCTCGAGAAATCGATCTCTTCCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054056
VALIDATED
PAWR MISSION shRNA shRNA Plasmid DNA
PRKC, apoptosis, WT1, regulator
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1575s21c1
Sequence:CCGGTTGGCCTACAATGCCTTATTACTCGAGTAATAAGGCATTGTAGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-867s21c1
Sequence:CCGGAGAAGATGAAATCTCAAATAGCTCGAGCTATTTGAGATTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1499s21c1
Sequence:CCGGTATCTACGTTAGCCCATATTCCTCGAGGAATATGGGCTAACGTAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1036s21c1
Sequence:CCGGGTGAGGCTGATGCAAGATAAACTCGAGTTTATCTTGCATCAGCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-826s21c1
Sequence:CCGGAGAACAGTTCCAGGCAGATACCTCGAGGTATCTGCCTGGAACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1074s21c1
Sequence:CCGGACTCAAGGAAGAGATCGATTTCTCGAGAAATCGATCTCTTCCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054056
VALIDATED
PAWR MISSION shRNA Lentiviral Transduction Particles
PRKC, apoptosis, WT1, regulator
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1575s21c1
Sequence:CCGGTTGGCCTACAATGCCTTATTACTCGAGTAATAAGGCATTGTAGGCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-867s21c1
Sequence:CCGGAGAAGATGAAATCTCAAATAGCTCGAGCTATTTGAGATTTCATCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1499s21c1
Sequence:CCGGTATCTACGTTAGCCCATATTCCTCGAGGAATATGGGCTAACGTAGATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1036s21c1
Sequence:CCGGGTGAGGCTGATGCAAGATAAACTCGAGTTTATCTTGCATCAGCCTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-826s21c1
Sequence:CCGGAGAACAGTTCCAGGCAGATACCTCGAGGTATCTGCCTGGAACTGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054056.2-1074s21c1
Sequence:CCGGACTCAAGGAAGAGATCGATTTCTCGAGAAATCGATCTCTTCCTTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002583
VALIDATED
PAWR MISSION shRNA Bacterial Glycerol Stock
PRKC, apoptosis, WT1, regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1223s21c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-945s21c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-796s21c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-960s1c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1002s21c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-754s1c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-1102s1c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002583.1-1181s1c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-903s1c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1144s21c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002583
VALIDATED
PAWR MISSION shRNA shRNA Plasmid DNA
PRKC, apoptosis, WT1, regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1223s21c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-945s21c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-796s21c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-960s1c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1002s21c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-754s1c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-1102s1c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002583.1-1181s1c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-903s1c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1144s21c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002583
VALIDATED
PAWR MISSION shRNA Lentiviral Transduction Particles
PRKC, apoptosis, WT1, regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1223s21c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-945s21c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-796s21c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000020306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-960s1c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1002s21c1
Sequence:CCGGGTAGATATTCTCGAACAGATACTCGAGTATCTGTTCGAGAATATCTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000020304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-754s1c1
Sequence:CCGGCGCAGAGTGCTTAGATGAGTACTCGAGTACTCATCTAAGCACTCTGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000020307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-1102s1c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000020308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002583.1-1181s1c1
Sequence:CCGGGACCTAGATGACATAGAAGATCTCGAGATCTTCTATGTCATCTAGGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000020305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002583.1-903s1c1
Sequence:CCGGGAACAGTTTCAGGCAGATATACTCGAGTATATCTGCCTGAAACTGTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002583.2-1144s21c1
Sequence:CCGGCCTAAGACTTGTGAGACTGATCTCGAGATCAGTCTCACAAGTCTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125814
PAWR MISSION shRNA Bacterial Glycerol Stock
PRKC, apoptosis, WT1, regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-898s1c1
Sequence:CCGGCCTATCGTGAACACTGATAATCTCGAGATTATCAGTGTTCACGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1342s1c1
Sequence:CCGGCCAGGTTCTGTGTGGGAATTTCTCGAGAAATTCCCACACAGAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-676s1c1
Sequence:CCGGGAAGTTGTAAGAGAAAGGCAACTCGAGTTGCCTTTCTCTTACAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1216s1c1
Sequence:CCGGGCTCAAGAGAATGATTTCTTTCTCGAGAAAGAAATCATTCTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1116s1c1
Sequence:CCGGCGAGAGTACCACGGGATTTATCTCGAGATAAATCCCGTGGTACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125814
PAWR MISSION shRNA shRNA Plasmid DNA
PRKC, apoptosis, WT1, regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-898s1c1
Sequence:CCGGCCTATCGTGAACACTGATAATCTCGAGATTATCAGTGTTCACGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1342s1c1
Sequence:CCGGCCAGGTTCTGTGTGGGAATTTCTCGAGAAATTCCCACACAGAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-676s1c1
Sequence:CCGGGAAGTTGTAAGAGAAAGGCAACTCGAGTTGCCTTTCTCTTACAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1216s1c1
Sequence:CCGGGCTCAAGAGAATGATTTCTTTCTCGAGAAAGAAATCATTCTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1116s1c1
Sequence:CCGGCGAGAGTACCACGGGATTTATCTCGAGATAAATCCCGTGGTACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125814
PAWR MISSION shRNA Lentiviral Transduction Particles
PRKC, apoptosis, WT1, regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-898s1c1
Sequence:CCGGCCTATCGTGAACACTGATAATCTCGAGATTATCAGTGTTCACGATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1342s1c1
Sequence:CCGGCCAGGTTCTGTGTGGGAATTTCTCGAGAAATTCCCACACAGAACCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-676s1c1
Sequence:CCGGGAAGTTGTAAGAGAAAGGCAACTCGAGTTGCCTTTCTCTTACAACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1216s1c1
Sequence:CCGGGCTCAAGAGAATGATTTCTTTCTCGAGAAAGAAATCATTCTCTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125814.4-1116s1c1
Sequence:CCGGCGAGAGTACCACGGGATTTATCTCGAGATAAATCCCGTGGTACTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???