EMAIL THIS PAGE TO A FRIEND

PAX1

paired box 1

67 Gene Product Result for
Synonyms: HUP48
UniProtKB ID: P15863, B4E0D6, Q642X9, Q6NTC0, Q9Y558
Gene ID:
Human(5075) Summary: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012]
Mouse(18503) paired box gene 1
Rat(311505) paired box 1
chicken(100859138) paired box 1
dog(485743) paired box 1
cow(537696) paired box 1
sheep(101102749) paired box 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101727 Anti-PAX1 (ab1) antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, rabbit, mouse
western blot pricing
SAB2101728 Anti-PAX1 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, mouse, human, rat, horse
western blot pricing
SAB2501444 Anti-PAX1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig, human, canine, bovine
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006192 Rosetta Predictions human pricing
NM_001107787 Rosetta Predictions rat pricing
NM_008780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068690 predicted 571
2 SASI_Hs02_00341073 predicted 997
3 SASI_Hs01_00068691 predicted 747
4 SASI_Hs01_00068693 predicted 477
5 SASI_Hs01_00068694 predicted 1064
6 SASI_Hs01_00068695 predicted 1304
7 SASI_Hs01_00068696 predicted 1023
8 SASI_Hs01_00068697 predicted 342
9 SASI_Hs01_00068698 predicted 943
10 SASI_Hs02_00341074 predicted 1163
11 SASI_Hs01_00068689 predicted 995
12 SASI_Hs01_00068692 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232265 predicted 1180
2 SASI_Rn02_00232266 predicted 1168
3 SASI_Rn02_00232267 predicted 1703
4 SASI_Rn02_00232268 predicted 1557
5 SASI_Rn02_00232269 predicted 1434
6 SASI_Rn02_00232270 predicted 1322
7 SASI_Rn02_00232271 predicted 1155
8 SASI_Rn02_00232272 predicted 1292
9 SASI_Rn02_00232273 predicted 2093
10 SASI_Rn02_00232274 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061725 predicted 565
2 SASI_Mm01_00061726 predicted 527
3 SASI_Mm01_00061727 predicted 1374
4 SASI_Mm01_00061728 predicted 817
5 SASI_Mm01_00061729 predicted 693
6 SASI_Mm01_00061730 predicted 750
7 SASI_Mm01_00061731 predicted 965
8 SASI_Mm01_00061732 predicted 729
9 SASI_Mm02_00314678 predicted 491
10 SASI_Mm01_00061733 predicted 791
11 SASI_Mm01_00061734 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008780
PAX1 MISSION shRNA Bacterial Glycerol Stock
paired box 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008780.1-2085s1c1
Sequence:CCGGGCTGGCTTTGTTTCTACGTTACTCGAGTAACGTAGAAACAAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-702s1c1
Sequence:CCGGCTACAATCATATCTACCAGTACTCGAGTACTGGTAGATATGATTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-319s1c1
Sequence:CCGGCGCCTACGAATCGTGGAGCTACTCGAGTAGCTCCACGATTCGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-967s1c1
Sequence:CCGGGCAGTGAATGGACTCGAGAAACTCGAGTTTCTCGAGTCCATTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-825s1c1
Sequence:CCGGCGCACATTCAGTCAGCAACATCTCGAGATGTTGCTGACTGAATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-1143s21c1
Sequence:CCGGTTCCAACCAGCACGGAGTATACTCGAGTATACTCCGTGCTGGTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008780.2-1635s21c1
Sequence:CCGGTCCTGCATCCACCTCAATTTACTCGAGTAAATTGAGGTGGATGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-678s21c1
Sequence:CCGGCAGTCGCATCCTGCGAAATAACTCGAGTTATTTCGCAGGATGCGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008780
PAX1 MISSION shRNA shRNA Plasmid DNA
paired box 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008780.1-2085s1c1
Sequence:CCGGGCTGGCTTTGTTTCTACGTTACTCGAGTAACGTAGAAACAAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-702s1c1
Sequence:CCGGCTACAATCATATCTACCAGTACTCGAGTACTGGTAGATATGATTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-319s1c1
Sequence:CCGGCGCCTACGAATCGTGGAGCTACTCGAGTAGCTCCACGATTCGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-967s1c1
Sequence:CCGGGCAGTGAATGGACTCGAGAAACTCGAGTTTCTCGAGTCCATTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-825s1c1
Sequence:CCGGCGCACATTCAGTCAGCAACATCTCGAGATGTTGCTGACTGAATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-1143s21c1
Sequence:CCGGTTCCAACCAGCACGGAGTATACTCGAGTATACTCCGTGCTGGTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008780.2-1635s21c1
Sequence:CCGGTCCTGCATCCACCTCAATTTACTCGAGTAAATTGAGGTGGATGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-678s21c1
Sequence:CCGGCAGTCGCATCCTGCGAAATAACTCGAGTTATTTCGCAGGATGCGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008780
PAX1 MISSION shRNA Lentiviral Transduction Particles
paired box 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008780.1-2085s1c1
Sequence:CCGGGCTGGCTTTGTTTCTACGTTACTCGAGTAACGTAGAAACAAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-702s1c1
Sequence:CCGGCTACAATCATATCTACCAGTACTCGAGTACTGGTAGATATGATTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-319s1c1
Sequence:CCGGCGCCTACGAATCGTGGAGCTACTCGAGTAGCTCCACGATTCGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-967s1c1
Sequence:CCGGGCAGTGAATGGACTCGAGAAACTCGAGTTTCTCGAGTCCATTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008780.1-825s1c1
Sequence:CCGGCGCACATTCAGTCAGCAACATCTCGAGATGTTGCTGACTGAATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-1143s21c1
Sequence:CCGGTTCCAACCAGCACGGAGTATACTCGAGTATACTCCGTGCTGGTTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008780.2-1635s21c1
Sequence:CCGGTCCTGCATCCACCTCAATTTACTCGAGTAAATTGAGGTGGATGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008780.2-678s21c1
Sequence:CCGGCAGTCGCATCCTGCGAAATAACTCGAGTTATTTCGCAGGATGCGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006192
PAX1 MISSION shRNA Bacterial Glycerol Stock
paired box 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-724s1c1
Sequence:CCGGGCAGTGAATGGGCTAGAGAAACTCGAGTTTCTCTAGCCCATTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-324s1c1
Sequence:CCGGCGACGGCGTCTGTGACAAGTACTCGAGTACTTGTCACAGACGCCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-745s1c1
Sequence:CCGGCCTGCCTTAGAGGCAGACATTCTCGAGAATGTCTGCCTCTAAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-613s1c1
Sequence:CCGGCGGACGTTTATGGAGCAAACACTCGAGTGTTTGCTCCATAAACGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006192.3-993s21c1
Sequence:CCGGCACCGCTTACTCTCCCAAGATCTCGAGATCTTGGGAGAGTAAGCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006192.3-1703s21c1
Sequence:CCGGTTCGCTCTGCCAGCTTCAAATCTCGAGATTTGAAGCTGGCAGAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006192
PAX1 MISSION shRNA shRNA Plasmid DNA
paired box 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-724s1c1
Sequence:CCGGGCAGTGAATGGGCTAGAGAAACTCGAGTTTCTCTAGCCCATTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-324s1c1
Sequence:CCGGCGACGGCGTCTGTGACAAGTACTCGAGTACTTGTCACAGACGCCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-745s1c1
Sequence:CCGGCCTGCCTTAGAGGCAGACATTCTCGAGAATGTCTGCCTCTAAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-613s1c1
Sequence:CCGGCGGACGTTTATGGAGCAAACACTCGAGTGTTTGCTCCATAAACGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006192.3-993s21c1
Sequence:CCGGCACCGCTTACTCTCCCAAGATCTCGAGATCTTGGGAGAGTAAGCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006192.3-1703s21c1
Sequence:CCGGTTCGCTCTGCCAGCTTCAAATCTCGAGATTTGAAGCTGGCAGAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006192
PAX1 MISSION shRNA Lentiviral Transduction Particles
paired box 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-724s1c1
Sequence:CCGGGCAGTGAATGGGCTAGAGAAACTCGAGTTTCTCTAGCCCATTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-324s1c1
Sequence:CCGGCGACGGCGTCTGTGACAAGTACTCGAGTACTTGTCACAGACGCCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-745s1c1
Sequence:CCGGCCTGCCTTAGAGGCAGACATTCTCGAGAATGTCTGCCTCTAAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006192.1-613s1c1
Sequence:CCGGCGGACGTTTATGGAGCAAACACTCGAGTGTTTGCTCCATAAACGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006192.3-993s21c1
Sequence:CCGGCACCGCTTACTCTCCCAAGATCTCGAGATCTTGGGAGAGTAAGCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006192.3-1703s21c1
Sequence:CCGGTTCGCTCTGCCAGCTTCAAATCTCGAGATTTGAAGCTGGCAGAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)