EMAIL THIS PAGE TO A FRIEND

PAX4

paired box 4

98 Gene Product Result for
Synonyms: KPD MODY9
UniProtKB ID: O43316, O95161, Q6B0H0
Gene ID:
Human(5078) Summary: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The paired box 4 gene is involved in pancreatic islet development and mouse studies have demonstrated a role for this gene in differentiation of insulin-producing beta cells. [provided by RefSeq, Jul 2008]
Mouse(18506) paired box gene 4
Rat(83630) paired box 4
Zebrafish(561564) paired box 4
dog(482268) paired box 4
cow(526172) paired box 4
sheep(554328) paired box 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006193 Rosetta Predictions human pricing
NM_031799 Rosetta Predictions rat pricing
NM_011038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219702 predicted 1258
2 SASI_Hs01_00219703 predicted 279
3 SASI_Hs01_00219704 predicted 306
4 SASI_Hs01_00219705 predicted 497
5 SASI_Hs01_00219706 predicted 326
6 SASI_Hs01_00219707 predicted 1241
7 SASI_Hs02_00341075 predicted 370
8 SASI_Hs01_00219708 predicted 478
9 SASI_Hs01_00219710 predicted 356
10 SASI_Hs01_00219711 predicted 328
11 SASI_Hs01_00219709 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035591 predicted 312
2 SASI_Rn01_00035592 predicted 725
3 SASI_Rn02_00265243 predicted 220
4 SASI_Rn01_00035594 predicted 400
5 SASI_Rn02_00265244 predicted 357
6 SASI_Rn01_00035595 predicted 614
7 SASI_Rn01_00035596 predicted 681
8 SASI_Rn01_00035597 predicted 304
9 SASI_Rn01_00035598 predicted 386
10 SASI_Rn01_00035599 predicted 206
11 SASI_Rn01_00035593 predicted 362
12 SASI_Rn01_00035600 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145106 predicted 519
2 SASI_Mm01_00145107 predicted 395
3 SASI_Mm01_00145108 predicted 345
4 SASI_Mm01_00145109 predicted 954
5 SASI_Mm01_00145110 predicted 605
6 SASI_Mm01_00145111 predicted 769
7 SASI_Mm01_00145112 predicted 521
8 SASI_Mm01_00145113 predicted 764
9 SASI_Mm01_00145114 predicted 1041
10 SASI_Mm01_00145115 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011038
PAX4 MISSION shRNA Bacterial Glycerol Stock
paired box 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-826s21c1
Sequence:CCGGAGTTTCAGCGTGGGCAGTATCCTCGAGGATACTGCCCACGCTGAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-459s21c1
Sequence:CCGGGTCTTGGAACCCAAGTGTATTCTCGAGAATACACTTGGGTTCCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-349s21c1
Sequence:CCGGAGATTGTGCAGCTAGCAATAACTCGAGTTATTGCTAGCTGCACAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-519s21c1
Sequence:CCGGGCTCGAATTGCCCAGCTAAAGCTCGAGCTTTAGCTGGGCAATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-329s1c1
Sequence:CCGGTGACATTTCACGGAGCCTTAACTCGAGTTAAGGCTCCGTGAAATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-339s1c1
Sequence:CCGGCGGAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-567s1c1
Sequence:CCGGGTGTCCTCTATCAATCGAGTACTCGAGTACTCGATTGATAGAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-716s1c1
Sequence:CCGGCCACAGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-570s1c1
Sequence:CCGGTCCTCTATCAATCGAGTACTTCTCGAGAAGTACTCGATTGATAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011038
PAX4 MISSION shRNA shRNA Plasmid DNA
paired box 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-826s21c1
Sequence:CCGGAGTTTCAGCGTGGGCAGTATCCTCGAGGATACTGCCCACGCTGAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-459s21c1
Sequence:CCGGGTCTTGGAACCCAAGTGTATTCTCGAGAATACACTTGGGTTCCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-349s21c1
Sequence:CCGGAGATTGTGCAGCTAGCAATAACTCGAGTTATTGCTAGCTGCACAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-519s21c1
Sequence:CCGGGCTCGAATTGCCCAGCTAAAGCTCGAGCTTTAGCTGGGCAATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-329s1c1
Sequence:CCGGTGACATTTCACGGAGCCTTAACTCGAGTTAAGGCTCCGTGAAATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-339s1c1
Sequence:CCGGCGGAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-567s1c1
Sequence:CCGGGTGTCCTCTATCAATCGAGTACTCGAGTACTCGATTGATAGAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-716s1c1
Sequence:CCGGCCACAGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-570s1c1
Sequence:CCGGTCCTCTATCAATCGAGTACTTCTCGAGAAGTACTCGATTGATAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011038
PAX4 MISSION shRNA Lentiviral Transduction Particles
paired box 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-826s21c1
Sequence:CCGGAGTTTCAGCGTGGGCAGTATCCTCGAGGATACTGCCCACGCTGAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-459s21c1
Sequence:CCGGGTCTTGGAACCCAAGTGTATTCTCGAGAATACACTTGGGTTCCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-349s21c1
Sequence:CCGGAGATTGTGCAGCTAGCAATAACTCGAGTTATTGCTAGCTGCACAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011038.2-519s21c1
Sequence:CCGGGCTCGAATTGCCCAGCTAAAGCTCGAGCTTTAGCTGGGCAATTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-329s1c1
Sequence:CCGGTGACATTTCACGGAGCCTTAACTCGAGTTAAGGCTCCGTGAAATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-339s1c1
Sequence:CCGGCGGAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-567s1c1
Sequence:CCGGGTGTCCTCTATCAATCGAGTACTCGAGTACTCGATTGATAGAGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-716s1c1
Sequence:CCGGCCACAGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011038.1-570s1c1
Sequence:CCGGTCCTCTATCAATCGAGTACTTCTCGAGAAGTACTCGATTGATAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006193
PAX4 MISSION shRNA Bacterial Glycerol Stock
paired box 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1257s21c1
Sequence:CCGGATGGCATAGAGAAGATCTAATCTCGAGATTAGATCTTCTCTATGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1536s21c1
Sequence:CCGGCCCTATGCCCACTCTAATATTCTCGAGAATATTAGAGTGGGCATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-315s1c1
Sequence:CCGGCGGATCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-692s1c1
Sequence:CCGGCCACCGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1120s1c1
Sequence:CCGGCCCTGGACTCAGGACTGCTTTCTCGAGAAAGCAGTCCTGAGTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006193.1-1666s1c1
Sequence:CCGGGCATCAATTTACCTACTCTATCTCGAGATAGAGTAGGTAAATTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006193.2-347s21c1
Sequence:CCGGCAAGATCCTAGGGCGTTACTACTCGAGTAGTAACGCCCTAGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1215s1c1
Sequence:CCGGCCACTACTGTATGGCTTGGAACTCGAGTTCCAAGCCATACAGTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006193
PAX4 MISSION shRNA shRNA Plasmid DNA
paired box 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1257s21c1
Sequence:CCGGATGGCATAGAGAAGATCTAATCTCGAGATTAGATCTTCTCTATGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1536s21c1
Sequence:CCGGCCCTATGCCCACTCTAATATTCTCGAGAATATTAGAGTGGGCATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-315s1c1
Sequence:CCGGCGGATCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-692s1c1
Sequence:CCGGCCACCGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1120s1c1
Sequence:CCGGCCCTGGACTCAGGACTGCTTTCTCGAGAAAGCAGTCCTGAGTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006193.1-1666s1c1
Sequence:CCGGGCATCAATTTACCTACTCTATCTCGAGATAGAGTAGGTAAATTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006193.2-347s21c1
Sequence:CCGGCAAGATCCTAGGGCGTTACTACTCGAGTAGTAACGCCCTAGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1215s1c1
Sequence:CCGGCCACTACTGTATGGCTTGGAACTCGAGTTCCAAGCCATACAGTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006193
PAX4 MISSION shRNA Lentiviral Transduction Particles
paired box 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1257s21c1
Sequence:CCGGATGGCATAGAGAAGATCTAATCTCGAGATTAGATCTTCTCTATGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006193.2-1536s21c1
Sequence:CCGGCCCTATGCCCACTCTAATATTCTCGAGAATATTAGAGTGGGCATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-315s1c1
Sequence:CCGGCGGATCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-692s1c1
Sequence:CCGGCCACCGGAATCGGACTATCTTCTCGAGAAGATAGTCCGATTCCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1120s1c1
Sequence:CCGGCCCTGGACTCAGGACTGCTTTCTCGAGAAAGCAGTCCTGAGTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006193.1-1666s1c1
Sequence:CCGGGCATCAATTTACCTACTCTATCTCGAGATAGAGTAGGTAAATTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006193.2-347s21c1
Sequence:CCGGCAAGATCCTAGGGCGTTACTACTCGAGTAGTAACGCCCTAGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006193.1-1215s1c1
Sequence:CCGGCCACTACTGTATGGCTTGGAACTCGAGTTCCAAGCCATACAGTAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)