EMAIL THIS PAGE TO A FRIEND

PAX5

paired box 5

69 Gene Product Result for
Synonyms: BSAP
Gene ID:
Human(5079) Summary: This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. PAX proteins are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternatively spliced transcript variants encoding different isoforms have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(18507) paired box gene 5
Rat(500453) paired box 5
sheep(101108719) paired box 5
Zebrafish(60636) paired box gene 5
cow(538371) paired box 5
Horse(100055252) paired box 5
chicken(387330) paired box 5
dog(612021) paired box 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016734 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069941 MISSION® esiRNA esiRNA targeting mouse Pax5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016734 Rosetta Predictions human pricing
NM_001109261 Rosetta Predictions rat pricing
NM_008782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029088 predicted 1937
2 SASI_Hs01_00029089 predicted 1491
3 SASI_Hs01_00029092 predicted 905
4 SASI_Hs01_00029093 predicted 1036
5 SASI_Hs02_00349865 predicted 1033
6 SASI_Hs01_00029095 predicted 1162
7 SASI_Hs02_00349866 predicted 1492
8 SASI_Hs01_00029097 predicted 1091
9 SASI_Hs02_00349867 predicted 1037
10 SASI_Hs02_00349868 predicted 1031
11 SASI_Hs01_00029090 predicted 2012
12 SASI_Hs01_00029091 predicted 831
13 SASI_Hs01_00029094 predicted 1221
14 SASI_Hs01_00029096 predicted 2086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246674 predicted 746
2 SASI_Rn02_00246675 predicted 672
3 SASI_Rn02_00246676 predicted 841
4 SASI_Rn02_00246677 predicted 615
5 SASI_Rn02_00246678 predicted 618
6 SASI_Rn02_00246679 predicted 817
7 SASI_Rn02_00246680 predicted 804
8 SASI_Rn02_00246681 predicted 484
9 SASI_Rn02_00246682 predicted 610
10 SASI_Rn02_00246683 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071223 predicted 618
2 SASI_Mm01_00071224 predicted 619
3 SASI_Mm01_00071225 predicted 922
4 SASI_Mm01_00071226 predicted 786
5 SASI_Mm01_00071227 predicted 816
6 SASI_Mm01_00071229 predicted 489
7 SASI_Mm01_00071230 predicted 616
8 SASI_Mm01_00071231 predicted 502
9 SASI_Mm01_00071232 predicted 916
10 SASI_Mm02_00314680 predicted 374
11 SASI_Mm01_00071228 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016734
PAX5 MISSION shRNA Bacterial Glycerol Stock
paired box 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-657s1c1
Sequence:CCGGGCAGGTATTATGAGACAGGAACTCGAGTTCCTGTCTCATAATACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016734.1-1937s21c1
Sequence:CCGGCTGACTATCCATCCATCATAACTCGAGTTATGATGGATGGATAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1492s1c1
Sequence:CCGGCCCTCAGTATTCCTCGTACAACTCGAGTTGTACGAGGAATACTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1037s1c1
Sequence:CCGGCGCAAGAGAGACGAAGGTATTCTCGAGAATACCTTCGTCTCTCTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016734.1-744s21c1
Sequence:CCGGTCGCTGAATATAAACGCCAAACTCGAGTTTGGCGTTTATATTCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016734.1-2665s1c1
Sequence:CCGGCCGGTGATGTAGACAATAATTCTCGAGAATTATTGTCTACATCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1177s1c1
Sequence:CCGGGCAGCACTACTCAGACATCTTCTCGAGAAGATGTCTGAGTAGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016734
PAX5 MISSION shRNA shRNA Plasmid DNA
paired box 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-657s1c1
Sequence:CCGGGCAGGTATTATGAGACAGGAACTCGAGTTCCTGTCTCATAATACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016734.1-1937s21c1
Sequence:CCGGCTGACTATCCATCCATCATAACTCGAGTTATGATGGATGGATAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1492s1c1
Sequence:CCGGCCCTCAGTATTCCTCGTACAACTCGAGTTGTACGAGGAATACTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1037s1c1
Sequence:CCGGCGCAAGAGAGACGAAGGTATTCTCGAGAATACCTTCGTCTCTCTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016734.1-744s21c1
Sequence:CCGGTCGCTGAATATAAACGCCAAACTCGAGTTTGGCGTTTATATTCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016734.1-2665s1c1
Sequence:CCGGCCGGTGATGTAGACAATAATTCTCGAGAATTATTGTCTACATCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1177s1c1
Sequence:CCGGGCAGCACTACTCAGACATCTTCTCGAGAAGATGTCTGAGTAGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016734
PAX5 MISSION shRNA Lentiviral Transduction Particles
paired box 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-657s1c1
Sequence:CCGGGCAGGTATTATGAGACAGGAACTCGAGTTCCTGTCTCATAATACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016734.1-1937s21c1
Sequence:CCGGCTGACTATCCATCCATCATAACTCGAGTTATGATGGATGGATAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1492s1c1
Sequence:CCGGCCCTCAGTATTCCTCGTACAACTCGAGTTGTACGAGGAATACTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1037s1c1
Sequence:CCGGCGCAAGAGAGACGAAGGTATTCTCGAGAATACCTTCGTCTCTCTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016734.1-744s21c1
Sequence:CCGGTCGCTGAATATAAACGCCAAACTCGAGTTTGGCGTTTATATTCAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016734.1-2665s1c1
Sequence:CCGGCCGGTGATGTAGACAATAATTCTCGAGAATTATTGTCTACATCACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016734.1-1177s1c1
Sequence:CCGGGCAGCACTACTCAGACATCTTCTCGAGAAGATGTCTGAGTAGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008782
PAX5 MISSION shRNA Bacterial Glycerol Stock
paired box 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-144s1c1
Sequence:CCGGCGCCAAAGGATAGTGGAACTTCTCGAGAAGTTCCACTATCCTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-563s1c1
Sequence:CCGGCTCATACTCCATCAGTGGCATCTCGAGATGCCACTGATGGAGTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-851s1c1
Sequence:CCGGCCTGGATGACATGAAAGCCAACTCGAGTTGGCTTTCATGTCATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-761s1c1
Sequence:CCGGACAGCACTACTCTGACATCTTCTCGAGAAGATGTCAGAGTAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-621s1c1
Sequence:CCGGCGCAAGAGGGATGAAGGTATTCTCGAGAATACCTTCATCCCTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-489s21c1
Sequence:CCGGGCTTCCAGTCACAGCATAGTGCTCGAGCACTATGCTGTGACTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-1035s21c1
Sequence:CCGGATGGTGCCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGGCACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-328s21c1
Sequence:CCGGTCGCTGAGTACAAACGCCAAACTCGAGTTTGGCGTTTGTACTCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008782
PAX5 MISSION shRNA shRNA Plasmid DNA
paired box 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-144s1c1
Sequence:CCGGCGCCAAAGGATAGTGGAACTTCTCGAGAAGTTCCACTATCCTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-563s1c1
Sequence:CCGGCTCATACTCCATCAGTGGCATCTCGAGATGCCACTGATGGAGTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-851s1c1
Sequence:CCGGCCTGGATGACATGAAAGCCAACTCGAGTTGGCTTTCATGTCATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-761s1c1
Sequence:CCGGACAGCACTACTCTGACATCTTCTCGAGAAGATGTCAGAGTAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-621s1c1
Sequence:CCGGCGCAAGAGGGATGAAGGTATTCTCGAGAATACCTTCATCCCTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-489s21c1
Sequence:CCGGGCTTCCAGTCACAGCATAGTGCTCGAGCACTATGCTGTGACTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-1035s21c1
Sequence:CCGGATGGTGCCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGGCACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-328s21c1
Sequence:CCGGTCGCTGAGTACAAACGCCAAACTCGAGTTTGGCGTTTGTACTCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008782
PAX5 MISSION shRNA Lentiviral Transduction Particles
paired box 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-144s1c1
Sequence:CCGGCGCCAAAGGATAGTGGAACTTCTCGAGAAGTTCCACTATCCTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-563s1c1
Sequence:CCGGCTCATACTCCATCAGTGGCATCTCGAGATGCCACTGATGGAGTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-851s1c1
Sequence:CCGGCCTGGATGACATGAAAGCCAACTCGAGTTGGCTTTCATGTCATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-761s1c1
Sequence:CCGGACAGCACTACTCTGACATCTTCTCGAGAAGATGTCAGAGTAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008782.1-621s1c1
Sequence:CCGGCGCAAGAGGGATGAAGGTATTCTCGAGAATACCTTCATCCCTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-489s21c1
Sequence:CCGGGCTTCCAGTCACAGCATAGTGCTCGAGCACTATGCTGTGACTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-1035s21c1
Sequence:CCGGATGGTGCCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGGCACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008782.2-328s21c1
Sequence:CCGGTCGCTGAGTACAAACGCCAAACTCGAGTTTGGCGTTTGTACTCAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)