EMAIL THIS PAGE TO A FRIEND

PAX6

paired box 6

126 Gene Product Result for
Synonyms: AN AN2 D11S812E MGDA WAGR
UniProtKB ID: P26367, Q6N006, Q99413
Gene ID:
Human(5080) Summary: This gene encodes paired box gene 6, one of many human homologs of the Drosophila melanogaster gene prd. In addition to the hallmark feature of this gene family, a conserved paired box domain, the encoded protein also contains a homeo box domain. Both domains are known to bind DNA and function as regulators of gene transcription. This gene is expressed in the developing nervous system, and in developing eyes. Mutations in this gene are known to cause ocular disorders such as aniridia and Peter's anomaly. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(18508) paired box gene 6
Rat(25509) paired box 6
chicken(395943) paired box 6
cow(286857) paired box 6
Horse(100146390) paired box 6
dog(483441) paired box 6
sheep(554264) paired box 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000280 Rosetta Predictions human pricing
NM_001127612 Rosetta Predictions human pricing
NM_001604 Rosetta Predictions human pricing
NM_013001 Rosetta Predictions rat pricing
NM_013627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119357 predicted 879
2 SASI_Hs02_00302237 predicted 1167
3 SASI_Hs01_00119358 predicted 1136
4 SASI_Hs01_00119359 predicted 1278
5 SASI_Hs01_00119360 predicted 1219
6 SASI_Hs01_00119361 predicted 890
7 SASI_Hs01_00119362 predicted 1229
8 SASI_Hs01_00119363 predicted 1076
9 SASI_Hs01_00119364 predicted 1248
10 SASI_Hs01_00119365 predicted 1462
11 SASI_Hs01_00119366 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329874 predicted 813
2 SASI_Hs02_00329875 predicted 1112
3 SASI_Hs02_00329876 predicted 1074
4 SASI_Hs02_00329877 predicted 1214
5 SASI_Hs02_00329878 predicted 1160
6 SASI_Hs02_00329879 predicted 821
7 SASI_Hs02_00329880 predicted 1167
8 SASI_Hs02_00329881 predicted 1014
9 SASI_Hs02_00329882 predicted 1182
10 SASI_Hs02_00329883 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148292 predicted 817
2 SASI_Hs02_00332155 predicted 1113
3 SASI_Hs01_00148293 predicted 1083
4 SASI_Hs01_00148294 predicted 1226
5 SASI_Hs01_00148295 predicted 1165
6 SASI_Hs01_00148296 predicted 828
7 SASI_Hs01_00148297 predicted 1176
8 SASI_Hs01_00148298 predicted 1022
9 SASI_Hs01_00148299 predicted 1186
10 SASI_Hs01_00148300 predicted 1405
11 SASI_Hs01_00148301 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064602 predicted 856
2 SASI_Rn01_00064604 predicted 1007
3 SASI_Rn01_00064605 predicted 1171
4 SASI_Rn01_00064606 predicted 1902
5 SASI_Rn01_00064608 predicted 1826
6 SASI_Rn01_00064609 predicted 283
7 SASI_Rn01_00064610 predicted 1772
8 SASI_Rn01_00064611 predicted 1862
9 SASI_Rn02_00260654 predicted 1912
10 SASI_Rn02_00260655 predicted 760
11 SASI_Rn01_00064603 predicted 2007
12 SASI_Rn01_00064607 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058527 predicted 1171
2 SASI_Mm01_00058528 predicted 1654
3 SASI_Mm01_00058529 predicted 859
4 SASI_Mm01_00058530 predicted 1316
5 SASI_Mm01_00058531 predicted 892
6 SASI_Mm01_00058532 predicted 1575
7 SASI_Mm01_00058533 predicted 1735
8 SASI_Mm01_00058534 predicted 1155
9 SASI_Mm01_00058536 predicted 1802
10 SASI_Mm02_00322405 predicted 1256
11 SASI_Mm01_00058535 predicted 1760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013627
PAX6 MISSION shRNA Bacterial Glycerol Stock
paired box 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1249s21c1
Sequence:CCGGGAGTTTGAGAGGACCCATTATCTCGAGATAATGGGTCCTCTCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013627.4-2024s21c1
Sequence:CCGGACGGTATCAGTTGGAACAAATCTCGAGATTTGTTCCAACTGATACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1655s21c1
Sequence:CCGGCAGTGAATGGGCGGAGTTATGCTCGAGCATAACTCCGCCCATTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1811s21c1
Sequence:CCGGCTCAGTACTGGCCTCGATTACCTCGAGGTAATCGAGGCCAGTACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013627.2-2280s1c1
Sequence:CCGGCCAAGTTTGTATCATTCCTTTCTCGAGAAAGGAATGATACAAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-989s1c1
Sequence:CCGGGACGGCATGTATGATAAACTACTCGAGTAGTTTATCATACATGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1743s1c1
Sequence:CCGGCCACTTCAACAGGACTCATTTCTCGAGAAATGAGTCCTGTTGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1579s1c1
Sequence:CCGGCATGGCAAACAACCTGCCTATCTCGAGATAGGCAGGTTGTTTGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1319s1c1
Sequence:CCGGCCTGAAGCAAGAATACAGGTACTCGAGTACCTGTATTCTTGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013627
PAX6 MISSION shRNA shRNA Plasmid DNA
paired box 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1249s21c1
Sequence:CCGGGAGTTTGAGAGGACCCATTATCTCGAGATAATGGGTCCTCTCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013627.4-2024s21c1
Sequence:CCGGACGGTATCAGTTGGAACAAATCTCGAGATTTGTTCCAACTGATACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1655s21c1
Sequence:CCGGCAGTGAATGGGCGGAGTTATGCTCGAGCATAACTCCGCCCATTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1811s21c1
Sequence:CCGGCTCAGTACTGGCCTCGATTACCTCGAGGTAATCGAGGCCAGTACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013627.2-2280s1c1
Sequence:CCGGCCAAGTTTGTATCATTCCTTTCTCGAGAAAGGAATGATACAAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-989s1c1
Sequence:CCGGGACGGCATGTATGATAAACTACTCGAGTAGTTTATCATACATGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1743s1c1
Sequence:CCGGCCACTTCAACAGGACTCATTTCTCGAGAAATGAGTCCTGTTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1579s1c1
Sequence:CCGGCATGGCAAACAACCTGCCTATCTCGAGATAGGCAGGTTGTTTGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1319s1c1
Sequence:CCGGCCTGAAGCAAGAATACAGGTACTCGAGTACCTGTATTCTTGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013627
PAX6 MISSION shRNA Lentiviral Transduction Particles
paired box 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1249s21c1
Sequence:CCGGGAGTTTGAGAGGACCCATTATCTCGAGATAATGGGTCCTCTCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013627.4-2024s21c1
Sequence:CCGGACGGTATCAGTTGGAACAAATCTCGAGATTTGTTCCAACTGATACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1655s21c1
Sequence:CCGGCAGTGAATGGGCGGAGTTATGCTCGAGCATAACTCCGCCCATTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013627.4-1811s21c1
Sequence:CCGGCTCAGTACTGGCCTCGATTACCTCGAGGTAATCGAGGCCAGTACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013627.2-2280s1c1
Sequence:CCGGCCAAGTTTGTATCATTCCTTTCTCGAGAAAGGAATGATACAAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-989s1c1
Sequence:CCGGGACGGCATGTATGATAAACTACTCGAGTAGTTTATCATACATGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1743s1c1
Sequence:CCGGCCACTTCAACAGGACTCATTTCTCGAGAAATGAGTCCTGTTGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1579s1c1
Sequence:CCGGCATGGCAAACAACCTGCCTATCTCGAGATAGGCAGGTTGTTTGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013627.2-1319s1c1
Sequence:CCGGCCTGAAGCAAGAATACAGGTACTCGAGTACCTGTATTCTTGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000280
VALIDATED
PAX6 MISSION shRNA Bacterial Glycerol Stock
paired box 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-738s21c2
Sequence:CCGGAGGGCAATCGGTGGTAGTAAACTCGAGTTTACTACCACCGATTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1368s21c2
Sequence:CCGGAGCAACACACCTAGTCATATTCTCGAGAATATGACTAGGTGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-1216s21c2
Sequence:CCGGAGTTTGAGAGAACCCATTATCCTCGAGGATAATGGGTTCTCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1620s21c2
Sequence:CCGGTCGGTGAATGGGCGGAGTTATCTCGAGATAACTCCGCCCATTCACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000280.3-4115s21c2
Sequence:GTACCGGATACGCACTGTTGGTACAATTCTCGAGAATTGTACCAACAGTGCGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1171s1c1
Sequence:CCGGGCAAGAATACAGGTATGGTTTCTCGAGAAACCATACCTGTATTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1425s1c1
Sequence:CCGGCATGGCAAATAACCTGCCTATCTCGAGATAGGCAGGTTATTTGCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-832s1c1
Sequence:CCGGGCAGACGGCATGTATGATAAACTCGAGTTTATCATACATGCCGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000280.1-701s1c1
Sequence:CCGGCGTCCATCTTTGCTTGGGAAACTCGAGTTTCCCAAGCAAAGATGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000280
VALIDATED
PAX6 MISSION shRNA shRNA Plasmid DNA
paired box 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-738s21c2
Sequence:CCGGAGGGCAATCGGTGGTAGTAAACTCGAGTTTACTACCACCGATTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1368s21c2
Sequence:CCGGAGCAACACACCTAGTCATATTCTCGAGAATATGACTAGGTGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-1216s21c2
Sequence:CCGGAGTTTGAGAGAACCCATTATCCTCGAGGATAATGGGTTCTCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1620s21c2
Sequence:CCGGTCGGTGAATGGGCGGAGTTATCTCGAGATAACTCCGCCCATTCACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000280.3-4115s21c2
Sequence:GTACCGGATACGCACTGTTGGTACAATTCTCGAGAATTGTACCAACAGTGCGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1171s1c1
Sequence:CCGGGCAAGAATACAGGTATGGTTTCTCGAGAAACCATACCTGTATTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1425s1c1
Sequence:CCGGCATGGCAAATAACCTGCCTATCTCGAGATAGGCAGGTTATTTGCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-832s1c1
Sequence:CCGGGCAGACGGCATGTATGATAAACTCGAGTTTATCATACATGCCGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000280.1-701s1c1
Sequence:CCGGCGTCCATCTTTGCTTGGGAAACTCGAGTTTCCCAAGCAAAGATGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000280
VALIDATED
PAX6 MISSION shRNA Lentiviral Transduction Particles
paired box 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-738s21c2
Sequence:CCGGAGGGCAATCGGTGGTAGTAAACTCGAGTTTACTACCACCGATTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1368s21c2
Sequence:CCGGAGCAACACACCTAGTCATATTCTCGAGAATATGACTAGGTGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000280.3-1216s21c2
Sequence:CCGGAGTTTGAGAGAACCCATTATCCTCGAGGATAATGGGTTCTCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000280.3-1620s21c2
Sequence:CCGGTCGGTGAATGGGCGGAGTTATCTCGAGATAACTCCGCCCATTCACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000280.3-4115s21c2
Sequence:GTACCGGATACGCACTGTTGGTACAATTCTCGAGAATTGTACCAACAGTGCGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1171s1c1
Sequence:CCGGGCAAGAATACAGGTATGGTTTCTCGAGAAACCATACCTGTATTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-1425s1c1
Sequence:CCGGCATGGCAAATAACCTGCCTATCTCGAGATAGGCAGGTTATTTGCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000280.1-832s1c1
Sequence:CCGGGCAGACGGCATGTATGATAAACTCGAGTTTATCATACATGCCGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000280.1-701s1c1
Sequence:CCGGCGTCCATCTTTGCTTGGGAAACTCGAGTTTCCCAAGCAAAGATGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)