EMAIL THIS PAGE TO A FRIEND

PAXBP1

PAX3 and PAX7 binding protein 1

265 Gene Product Result for
Synonyms: BM020 C21orf66 FSAP105 GCFC GCFC1
UniProtKB ID: Q9Y5B6, D3DSE7, Q96DU8, Q9NYQ0
Gene ID:
Human(94104) Summary: This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(67367) PAX3 and PAX7 binding protein 1
Rat(681004) PAX3 and PAX7 binding protein 1
naked mole-rat(101719103) PAX3 and PAX7 binding protein 1
domestic guinea pig(100718936) PAX3 and PAX7 binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_358888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013329 Rosetta Predictions human pricing
NM_016631 Rosetta Predictions human pricing
NM_058191 Rosetta Predictions human pricing
NM_145328 Rosetta Predictions human pricing
XM_001057248 Rosetta Predictions rat pricing
XM_001057305 Rosetta Predictions rat pricing
XM_358888 Rosetta Predictions mouse pricing
XM_896855 Rosetta Predictions mouse pricing
XM_896860 Rosetta Predictions mouse pricing
XM_904433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072240 predicted 1139
2 SASI_Hs01_00072241 predicted 1182
3 SASI_Hs01_00072242 predicted 1068
4 SASI_Hs01_00072243 predicted 986
5 SASI_Hs01_00072244 predicted 894
6 SASI_Hs01_00072245 predicted 773
7 SASI_Hs01_00072246 predicted 1265
8 SASI_Hs01_00072247 predicted 940
9 SASI_Hs01_00072248 predicted 1321
10 SASI_Hs01_00072249 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102947 predicted 1147
2 SASI_Hs01_00102948 predicted 1186
3 SASI_Hs01_00102949 predicted 1068
4 SASI_Hs01_00102950 predicted 989
5 SASI_Hs01_00102951 predicted 892
6 SASI_Hs01_00102952 predicted 780
7 SASI_Hs01_00102953 predicted 1274
8 SASI_Hs01_00102954 predicted 937
9 SASI_Hs01_00102955 predicted 1322
10 SASI_Hs01_00102956 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177827 predicted 1148
2 SASI_Hs01_00177828 predicted 1188
3 SASI_Hs01_00177829 predicted 1074
4 SASI_Hs01_00177830 predicted 993
5 SASI_Hs01_00177831 predicted 894
6 SASI_Hs01_00177832 predicted 781
7 SASI_Hs01_00177833 predicted 1274
8 SASI_Hs01_00177834 predicted 943
9 SASI_Hs01_00177835 predicted 1323
10 SASI_Hs01_00177836 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203524 predicted 981
2 SASI_Hs01_00203525 predicted 1016
3 SASI_Hs01_00203526 predicted 901
4 SASI_Hs01_00203527 predicted 826
5 SASI_Hs01_00203528 predicted 730
6 SASI_Hs01_00203529 predicted 606
7 SASI_Hs01_00203530 predicted 1109
8 SASI_Hs01_00203531 predicted 781
9 SASI_Hs01_00203532 predicted 1160
10 SASI_Hs01_00203533 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285815 predicted 1152
2 SASI_Rn02_00285816 predicted 1032
3 SASI_Rn02_00285817 predicted 342
4 SASI_Rn02_00285818 predicted 1156
5 SASI_Rn02_00285819 predicted 798
6 SASI_Rn02_00285820 predicted 1045
7 SASI_Rn02_00285821 predicted 1108
8 SASI_Rn02_00285822 predicted 1139
9 SASI_Rn02_00285823 predicted 952
10 SASI_Rn02_00285824 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285943 predicted 2587
2 SASI_Rn02_00285944 predicted 1220
3 SASI_Rn02_00285945 predicted 798
4 SASI_Rn02_00285946 predicted 2076
5 SASI_Rn02_00285947 predicted 2417
6 SASI_Rn02_00285948 predicted 2827
7 SASI_Rn02_00285949 predicted 1110
8 SASI_Rn02_00285950 predicted 1141
9 SASI_Rn02_00285951 predicted 1841
10 SASI_Rn02_00285952 predicted 2392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206702 predicted 1990
2 SASI_Mm01_00206703 predicted 1962
3 SASI_Mm01_00206704 predicted 2270
4 SASI_Mm01_00206705 predicted 2552
5 SASI_Mm01_00206706 predicted 2226
6 SASI_Mm02_00426274 predicted 1929
7 SASI_Mm02_00426275 predicted 2313
8 SASI_Mm02_00426276 predicted 1994
9 SASI_Mm02_00426277 predicted 1944
10 SASI_Mm02_00426278 predicted 2236
11 SASI_Mm01_00206700 predicted 2725
12 SASI_Mm01_00206701 predicted 2018
13 SASI_Mm01_00206707 predicted 2691
14 SASI_Mm01_00206708 predicted 1962
15 SASI_Mm01_00206709 predicted 2270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235423 predicted 1159
2 SASI_Mm01_00235424 predicted 450
3 SASI_Mm01_00235425 predicted 430
4 SASI_Mm01_00235426 predicted 394
5 SASI_Mm01_00235427 predicted 712
6 SASI_Mm01_00235428 predicted 991
7 SASI_Mm01_00235429 predicted 663
8 SASI_Mm01_00235430 predicted 1125
9 SASI_Mm01_00235431 predicted 393
10 SASI_Mm01_00235432 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234955 predicted 3615
2 SASI_Mm01_00234956 predicted 3475
3 SASI_Mm01_00234957 predicted 3771
4 SASI_Mm01_00234958 predicted 3736
5 SASI_Mm01_00234959 predicted 3628
6 SASI_Mm01_00234960 predicted 3588
7 SASI_Mm01_00234961 predicted 3768
8 SASI_Mm01_00234962 predicted 3719
9 SASI_Mm01_00234963 predicted 3470
10 SASI_Mm01_00234964 predicted 3634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430917 predicted 2739
2 SASI_Mm02_00430918 predicted 1486
3 SASI_Mm02_00430919 predicted 1989
4 SASI_Mm02_00430920 predicted 1958
5 SASI_Mm02_00430921 predicted 1379
6 SASI_Mm02_00430922 predicted 2266
7 SASI_Mm02_00430923 predicted 2554
8 SASI_Mm02_00430924 predicted 1805
9 SASI_Mm02_00430925 predicted 1263
10 SASI_Mm02_00430926 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358888
PAXBP1 MISSION shRNA Bacterial Glycerol Stock
PAX3 and PAX7 binding protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1874s21c1
Sequence:CCGGATCTGGAGAAAGATCGAATTTCTCGAGAAATTCGATCTTTCTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1047s21c1
Sequence:CCGGTGACGATGACGCGTTAGTAACCTCGAGGTTACTAACGCGTCATCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358888.5-3168s1c1
Sequence:CCGGCGTTTACGTATGCTCTATAAACTCGAGTTTATAGAGCATACGTAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1316s1c1
Sequence:CCGGCCGTTACTATTGATTTGGTAACTCGAGTTACCAAATCAATAGTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1827s1c1
Sequence:CCGGCCTTGAGAGTTTCTATTCAATCTCGAGATTGAATAGAAACTCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1468s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1849s21c1
Sequence:CCGGACGTCTACAGATATTACTAATCTCGAGATTAGTAATATCTGTAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358888
PAXBP1 MISSION shRNA shRNA Plasmid DNA
PAX3 and PAX7 binding protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1874s21c1
Sequence:CCGGATCTGGAGAAAGATCGAATTTCTCGAGAAATTCGATCTTTCTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1047s21c1
Sequence:CCGGTGACGATGACGCGTTAGTAACCTCGAGGTTACTAACGCGTCATCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358888.5-3168s1c1
Sequence:CCGGCGTTTACGTATGCTCTATAAACTCGAGTTTATAGAGCATACGTAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1316s1c1
Sequence:CCGGCCGTTACTATTGATTTGGTAACTCGAGTTACCAAATCAATAGTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1827s1c1
Sequence:CCGGCCTTGAGAGTTTCTATTCAATCTCGAGATTGAATAGAAACTCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1468s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1849s21c1
Sequence:CCGGACGTCTACAGATATTACTAATCTCGAGATTAGTAATATCTGTAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358888
PAXBP1 MISSION shRNA Lentiviral Transduction Particles
PAX3 and PAX7 binding protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1874s21c1
Sequence:CCGGATCTGGAGAAAGATCGAATTTCTCGAGAAATTCGATCTTTCTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1047s21c1
Sequence:CCGGTGACGATGACGCGTTAGTAACCTCGAGGTTACTAACGCGTCATCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358888.5-3168s1c1
Sequence:CCGGCGTTTACGTATGCTCTATAAACTCGAGTTTATAGAGCATACGTAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1316s1c1
Sequence:CCGGCCGTTACTATTGATTTGGTAACTCGAGTTACCAAATCAATAGTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358888.1-1827s1c1
Sequence:CCGGCCTTGAGAGTTTCTATTCAATCTCGAGATTGAATAGAAACTCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1468s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_358888.5-1849s21c1
Sequence:CCGGACGTCTACAGATATTACTAATCTCGAGATTAGTAATATCTGTAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016631
VALIDATED
PAXBP1 MISSION shRNA Bacterial Glycerol Stock
PAX3 and PAX7 binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-1241s21c1
Sequence:CCGGTATGGCATTCCTTATAGTTATCTCGAGATAACTATAAGGAATGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2518s21c1
Sequence:CCGGAGTTAAGCTGTTAGGCAATTTCTCGAGAAATTGCCTAACAGCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2759s21c1
Sequence:CCGGGTACACTTAGCGGATACAATTCTCGAGAATTGTATCCGCTAAGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016631.3-3227s21c1
Sequence:CCGGACGATGTGTGCAGTGTAAATTCTCGAGAATTTACACTGCACACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016631.3-1496s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016631.x-2793s1c1
Sequence:CCGGCTATTTGCTTGATTACCATTCCTCGAGGAATGGTAATCAAGCAAATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-903s1c1
Sequence:CCGGGTGATGATGATGCTTTAGTAACTCGAGTTACTAAAGCATCATCATCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-2255s1c1
Sequence:CCGGGATGATGTATTTATGCCCTTACTCGAGTAAGGGCATAAATACATCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-1220s1c1
Sequence:CCGGTCCATGAAAGAATTGCACAAACTCGAGTTTGTGCAATTCTTTCATGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016631.x-1033s1c1
Sequence:CCGGCCAGAACACTTACCAGACAATCTCGAGATTGTCTGGTAAGTGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016631
VALIDATED
PAXBP1 MISSION shRNA shRNA Plasmid DNA
PAX3 and PAX7 binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-1241s21c1
Sequence:CCGGTATGGCATTCCTTATAGTTATCTCGAGATAACTATAAGGAATGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2518s21c1
Sequence:CCGGAGTTAAGCTGTTAGGCAATTTCTCGAGAAATTGCCTAACAGCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2759s21c1
Sequence:CCGGGTACACTTAGCGGATACAATTCTCGAGAATTGTATCCGCTAAGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016631.3-3227s21c1
Sequence:CCGGACGATGTGTGCAGTGTAAATTCTCGAGAATTTACACTGCACACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016631.3-1496s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016631.x-2793s1c1
Sequence:CCGGCTATTTGCTTGATTACCATTCCTCGAGGAATGGTAATCAAGCAAATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-903s1c1
Sequence:CCGGGTGATGATGATGCTTTAGTAACTCGAGTTACTAAAGCATCATCATCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-2255s1c1
Sequence:CCGGGATGATGTATTTATGCCCTTACTCGAGTAAGGGCATAAATACATCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-1220s1c1
Sequence:CCGGTCCATGAAAGAATTGCACAAACTCGAGTTTGTGCAATTCTTTCATGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016631.x-1033s1c1
Sequence:CCGGCCAGAACACTTACCAGACAATCTCGAGATTGTCTGGTAAGTGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016631
VALIDATED
PAXBP1 MISSION shRNA Lentiviral Transduction Particles
PAX3 and PAX7 binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-1241s21c1
Sequence:CCGGTATGGCATTCCTTATAGTTATCTCGAGATAACTATAAGGAATGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2518s21c1
Sequence:CCGGAGTTAAGCTGTTAGGCAATTTCTCGAGAAATTGCCTAACAGCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016631.3-2759s21c1
Sequence:CCGGGTACACTTAGCGGATACAATTCTCGAGAATTGTATCCGCTAAGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016631.3-3227s21c1
Sequence:CCGGACGATGTGTGCAGTGTAAATTCTCGAGAATTTACACTGCACACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016631.3-1496s21c1
Sequence:CCGGGGTATTGGTGAACGGTATAAACTCGAGTTTATACCGTTCACCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016631.x-2793s1c1
Sequence:CCGGCTATTTGCTTGATTACCATTCCTCGAGGAATGGTAATCAAGCAAATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-903s1c1
Sequence:CCGGGTGATGATGATGCTTTAGTAACTCGAGTTACTAAAGCATCATCATCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-2255s1c1
Sequence:CCGGGATGATGTATTTATGCCCTTACTCGAGTAAGGGCATAAATACATCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016631.x-1220s1c1
Sequence:CCGGTCCATGAAAGAATTGCACAAACTCGAGTTTGTGCAATTCTTTCATGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016631.x-1033s1c1
Sequence:CCGGCCAGAACACTTACCAGACAATCTCGAGATTGTCTGGTAAGTGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)