EMAIL THIS PAGE TO A FRIEND

PBLD

phenazine biosynthesis-like protein domain containing

60 Gene Product Result for
Synonyms: MAWBP MAWDBP
UniProtKB ID: P30039, A8MZJ3, Q9HCC2
Gene ID:
chicken(423685) phenazine biosynthesis-like protein domain containing
domestic cat(101090293) phenazine biosynthesis-like protein domain containing
cow(504417) phenazine biosynthesis-like protein domain containing
dog(479226) phenazine biosynthesis-like protein domain containing
naked mole-rat(101698836) phenazine biosynthesis-like protein domain containing
domestic guinea pig(100717573) phenazine biosynthesis-like protein domain containing
sheep(101105627) phenazine biosynthesis-like protein domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022129 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097771 MISSION® esiRNA esiRNA human PBLD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033083 Rosetta Predictions human pricing
NM_022129 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197041 predicted 319
2 SASI_Hs01_00197042 predicted 562
3 SASI_Hs01_00197043 predicted 257
4 SASI_Hs01_00197044 predicted 539
5 SASI_Hs01_00197045 predicted 605
6 SASI_Hs01_00197046 predicted 359
7 SASI_Hs01_00197047 predicted 359
8 SASI_Hs01_00197048 predicted 321
9 SASI_Hs01_00197049 predicted 711
10 SASI_Hs01_00197050 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151532 predicted 323
2 SASI_Hs01_00151533 predicted 556
3 SASI_Hs01_00151534 predicted 260
4 SASI_Hs01_00151535 predicted 541
5 SASI_Hs01_00151536 predicted 603
6 SASI_Hs01_00151537 predicted 366
7 SASI_Hs01_00151538 predicted 363
8 SASI_Hs01_00151539 predicted 324
9 SASI_Hs01_00151540 predicted 714
10 SASI_Hs01_00151541 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022129
VALIDATED
PBLD MISSION shRNA Bacterial Glycerol Stock
phenazine biosynthesis-like protein domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022129.3-1006s21c1
Sequence:CCGGCAGACGGAAGGGTTGACATTACTCGAGTAATGTCAACCCTTCCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1095s21c1
Sequence:CCGGGTCTCTAACCACCAAGTATTTCTCGAGAAATACTTGGTGGTTAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1157s21c1
Sequence:CCGGTGCGTAGTAGTCTACTTAATCCTCGAGGATTAAGTAGACTACTACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-228s1c1
Sequence:CCGGCCGACAGACAACTTTGCACAACTCGAGTTGTGCAAAGTTGTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-647s1c1
Sequence:CCGGAGGGCTTATTCTTACCCTTAACTCGAGTTAAGGGTAAGAATAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-256s1c1
Sequence:CCGGGCTTTGGACTGAGATGGTTTACTCGAGTAAACCATCTCAGTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-477s1c1
Sequence:CCGGGACTTGATAAAGACTGCCATACTCGAGTATGGCAGTCTTTATCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022129.1-564s1c1
Sequence:CCGGGACGTTTACAACAGGTCGTTTCTCGAGAAACGACCTGTTGTAAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022129
VALIDATED
PBLD MISSION shRNA shRNA Plasmid DNA
phenazine biosynthesis-like protein domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022129.3-1006s21c1
Sequence:CCGGCAGACGGAAGGGTTGACATTACTCGAGTAATGTCAACCCTTCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1095s21c1
Sequence:CCGGGTCTCTAACCACCAAGTATTTCTCGAGAAATACTTGGTGGTTAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1157s21c1
Sequence:CCGGTGCGTAGTAGTCTACTTAATCCTCGAGGATTAAGTAGACTACTACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-228s1c1
Sequence:CCGGCCGACAGACAACTTTGCACAACTCGAGTTGTGCAAAGTTGTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-647s1c1
Sequence:CCGGAGGGCTTATTCTTACCCTTAACTCGAGTTAAGGGTAAGAATAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-256s1c1
Sequence:CCGGGCTTTGGACTGAGATGGTTTACTCGAGTAAACCATCTCAGTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-477s1c1
Sequence:CCGGGACTTGATAAAGACTGCCATACTCGAGTATGGCAGTCTTTATCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022129.1-564s1c1
Sequence:CCGGGACGTTTACAACAGGTCGTTTCTCGAGAAACGACCTGTTGTAAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022129
VALIDATED
PBLD MISSION shRNA Lentiviral Transduction Particles
phenazine biosynthesis-like protein domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022129.3-1006s21c1
Sequence:CCGGCAGACGGAAGGGTTGACATTACTCGAGTAATGTCAACCCTTCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1095s21c1
Sequence:CCGGGTCTCTAACCACCAAGTATTTCTCGAGAAATACTTGGTGGTTAGAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022129.3-1157s21c1
Sequence:CCGGTGCGTAGTAGTCTACTTAATCCTCGAGGATTAAGTAGACTACTACGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-228s1c1
Sequence:CCGGCCGACAGACAACTTTGCACAACTCGAGTTGTGCAAAGTTGTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-647s1c1
Sequence:CCGGAGGGCTTATTCTTACCCTTAACTCGAGTTAAGGGTAAGAATAAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-256s1c1
Sequence:CCGGGCTTTGGACTGAGATGGTTTACTCGAGTAAACCATCTCAGTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022129.1-477s1c1
Sequence:CCGGGACTTGATAAAGACTGCCATACTCGAGTATGGCAGTCTTTATCAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022129.1-564s1c1
Sequence:CCGGGACGTTTACAACAGGTCGTTTCTCGAGAAACGACCTGTTGTAAACGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)