EMAIL THIS PAGE TO A FRIEND

PBOV1

prostate and breast cancer overexpressed 1

16 Gene Product Result for
Synonyms: UC28 UROC28 dJ171N11.2
Species: Human PBOV1(59351)
UniProtKB ID: Q9GZY1
Gene ID:
Human(59351) Summary: This intronless gene encodes a protein of unknown function. Its expression is up-regulated in some types of cancer, including prostate, breast, and bladder cancer. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021635 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043259 predicted 358
2 SASI_Hs01_00043260 predicted 781
3 SASI_Hs01_00043261 predicted 715
4 SASI_Hs02_00354995 predicted 673
5 SASI_Hs01_00043262 predicted 546
6 SASI_Hs01_00043263 predicted 510
7 SASI_Hs01_00043264 predicted 294
8 SASI_Hs01_00043265 predicted 419
9 SASI_Hs01_00043266 predicted 595
10 SASI_Hs01_00043268 predicted 474
11 SASI_Hs01_00043267 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021635
PBOV1 MISSION shRNA Bacterial Glycerol Stock
prostate and breast cancer overexpressed 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-588s1c1
Sequence:CCGGCCAGCCAAGTAACTGAACCATCTCGAGATGGTTCAGTTACTTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-392s1c1
Sequence:CCGGCTCATTATCTTCAGAAGCCATCTCGAGATGGCTTCTGAAGATAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-677s1c1
Sequence:CCGGCCCATGTTGATCTTTCTCAATCTCGAGATTGAGAAAGATCAACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-376s1c1
Sequence:CCGGCCTCAATGAAATGTTCCTCATCTCGAGATGAGGAACATTTCATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-362s1c1
Sequence:CCGGGACCATGAAAGGTTCCTCAATCTCGAGATTGAGGAACCTTTCATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-219s1c1
Sequence:CCGGCCAGAAACTGTGCTCTTACCACTCGAGTGGTAAGAGCACAGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-350s1c1
Sequence:CCGGGCAGACACACTTGACCATGAACTCGAGTTCATGGTCAAGTGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-351s1c1
Sequence:CCGGCAGACACACTTGACCATGAAACTCGAGTTTCATGGTCAAGTGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-216s1c1
Sequence:CCGGGCTCCAGAAACTGTGCTCTTACTCGAGTAAGAGCACAGTTTCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021635
PBOV1 MISSION shRNA shRNA Plasmid DNA
prostate and breast cancer overexpressed 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-588s1c1
Sequence:CCGGCCAGCCAAGTAACTGAACCATCTCGAGATGGTTCAGTTACTTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-392s1c1
Sequence:CCGGCTCATTATCTTCAGAAGCCATCTCGAGATGGCTTCTGAAGATAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-677s1c1
Sequence:CCGGCCCATGTTGATCTTTCTCAATCTCGAGATTGAGAAAGATCAACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-376s1c1
Sequence:CCGGCCTCAATGAAATGTTCCTCATCTCGAGATGAGGAACATTTCATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-362s1c1
Sequence:CCGGGACCATGAAAGGTTCCTCAATCTCGAGATTGAGGAACCTTTCATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-219s1c1
Sequence:CCGGCCAGAAACTGTGCTCTTACCACTCGAGTGGTAAGAGCACAGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-350s1c1
Sequence:CCGGGCAGACACACTTGACCATGAACTCGAGTTCATGGTCAAGTGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-351s1c1
Sequence:CCGGCAGACACACTTGACCATGAAACTCGAGTTTCATGGTCAAGTGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-216s1c1
Sequence:CCGGGCTCCAGAAACTGTGCTCTTACTCGAGTAAGAGCACAGTTTCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021635
PBOV1 MISSION shRNA Lentiviral Transduction Particles
prostate and breast cancer overexpressed 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-588s1c1
Sequence:CCGGCCAGCCAAGTAACTGAACCATCTCGAGATGGTTCAGTTACTTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-392s1c1
Sequence:CCGGCTCATTATCTTCAGAAGCCATCTCGAGATGGCTTCTGAAGATAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021635.1-677s1c1
Sequence:CCGGCCCATGTTGATCTTTCTCAATCTCGAGATTGAGAAAGATCAACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-376s1c1
Sequence:CCGGCCTCAATGAAATGTTCCTCATCTCGAGATGAGGAACATTTCATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-362s1c1
Sequence:CCGGGACCATGAAAGGTTCCTCAATCTCGAGATTGAGGAACCTTTCATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-219s1c1
Sequence:CCGGCCAGAAACTGTGCTCTTACCACTCGAGTGGTAAGAGCACAGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-350s1c1
Sequence:CCGGGCAGACACACTTGACCATGAACTCGAGTTCATGGTCAAGTGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-351s1c1
Sequence:CCGGCAGACACACTTGACCATGAAACTCGAGTTTCATGGTCAAGTGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021635.1-216s1c1
Sequence:CCGGGCTCCAGAAACTGTGCTCTTACTCGAGTAAGAGCACAGTTTCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)