EMAIL THIS PAGE TO A FRIEND

PBRM1

polybromo 1

280 Gene Product Result for
Synonyms: BAF180 PB1
Gene ID:
Human(55193) Summary: This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
Mouse(66923) polybromo 1
Rat(306254) polybromo 1
Zebrafish(565366) polybromo 1
dog(476593) polybromo 1
chicken(396074) polybromo 1
Horse(100051687) polybromo 1
cow(506557) polybromo 1
sheep(101110274) polybromo 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075001 MISSION® esiRNA esiRNA human PBRM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018165 Rosetta Predictions human pricing
NM_018313 Rosetta Predictions human pricing
NM_181042 Rosetta Predictions human pricing
XM_001059112 Rosetta Predictions rat pricing
XM_001059164 Rosetta Predictions rat pricing
XM_001059228 Rosetta Predictions rat pricing
XM_001059293 Rosetta Predictions rat pricing
XM_001059347 Rosetta Predictions rat pricing
XM_001059404 Rosetta Predictions rat pricing
XM_001059461 Rosetta Predictions rat pricing
XM_001059525 Rosetta Predictions rat pricing
XM_001059577 Rosetta Predictions rat pricing
XM_240329 Rosetta Predictions rat pricing
NM_001081251 Rosetta Predictions mouse pricing
XM_619217 Rosetta Predictions mouse pricing
XM_889384 Rosetta Predictions mouse pricing
XM_898473 Rosetta Predictions mouse pricing
XM_898498 Rosetta Predictions mouse pricing
XM_898533 Rosetta Predictions mouse pricing
XM_898551 Rosetta Predictions mouse pricing
XM_898555 Rosetta Predictions mouse pricing
XM_982332 Rosetta Predictions mouse pricing
XM_982397 Rosetta Predictions mouse pricing
XM_982426 Rosetta Predictions mouse pricing
XM_982539 Rosetta Predictions mouse pricing
XM_982679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020122 predicted 4895
2 SASI_Hs01_00020123 predicted 251
3 SASI_Hs01_00020125 predicted 1975
4 SASI_Hs01_00020126 predicted 1996
5 SASI_Hs01_00020127 predicted 2065
6 SASI_Hs01_00020128 predicted 1313
7 SASI_Hs01_00020129 predicted 3155
8 SASI_Hs02_00351415 predicted 2307
9 SASI_Hs01_00020131 predicted 3584
10 SASI_Hs02_00351416 predicted 4756
11 SASI_Hs01_00020124 predicted 2150
12 SASI_Hs01_00020130 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192314 predicted 4940
2 SASI_Hs01_00192315 predicted 353
3 SASI_Hs01_00192317 predicted 2177
4 SASI_Hs01_00192318 predicted 2188
5 SASI_Hs01_00192319 predicted 2256
6 SASI_Hs01_00192320 predicted 1511
7 SASI_Hs01_00192321 predicted 3280
8 SASI_Hs02_00351726 predicted 2505
9 SASI_Hs01_00192323 predicted 3709
10 SASI_Hs02_00351727 predicted 4799
11 SASI_Hs01_00192316 predicted 2342
12 SASI_Hs01_00192322 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121991 predicted 4838
2 SASI_Hs01_00121992 predicted 251
3 SASI_Hs01_00121994 predicted 2066
4 SASI_Hs01_00121995 predicted 2091
5 SASI_Hs01_00121996 predicted 2160
6 SASI_Hs01_00121997 predicted 1409
7 SASI_Hs01_00121998 predicted 3258
8 SASI_Hs02_00369923 predicted 2402
9 SASI_Hs01_00122000 predicted 3686
10 SASI_Hs02_00369924 predicted 4695
11 SASI_Hs01_00121993 predicted 2236
12 SASI_Hs01_00121999 predicted 1987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292014 predicted 3331
2 SASI_Rn02_00292015 predicted 4073
3 SASI_Rn02_00292016 predicted 2393
4 SASI_Rn02_00292017 predicted 3994
5 SASI_Rn02_00292018 predicted 2647
6 SASI_Rn02_00292019 predicted 1938
7 SASI_Rn02_00292020 predicted 1339
8 SASI_Rn02_00292021 predicted 1117
9 SASI_Rn02_00292022 predicted 3578
10 SASI_Rn02_00292023 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292192 predicted 3450
2 SASI_Rn02_00292193 predicted 2852
3 SASI_Rn02_00292194 predicted 4185
4 SASI_Rn02_00292195 predicted 2434
5 SASI_Rn02_00292196 predicted 2692
6 SASI_Rn02_00292197 predicted 1975
7 SASI_Rn02_00292198 predicted 1340
8 SASI_Rn02_00292199 predicted 1114
9 SASI_Rn02_00292200 predicted 3693
10 SASI_Rn02_00292201 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292514 predicted 3400
2 SASI_Rn02_00292515 predicted 4580
3 SASI_Rn02_00292516 predicted 4144
4 SASI_Rn02_00292517 predicted 2390
5 SASI_Rn02_00292518 predicted 2640
6 SASI_Rn02_00292519 predicted 1933
7 SASI_Rn02_00292520 predicted 1340
8 SASI_Rn02_00292521 predicted 1119
9 SASI_Rn02_00292522 predicted 3648
10 SASI_Rn02_00292523 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292727 predicted 3352
2 SASI_Rn02_00292728 predicted 2748
3 SASI_Rn02_00292729 predicted 4095
4 SASI_Rn02_00292730 predicted 2340
5 SASI_Rn02_00292731 predicted 2588
6 SASI_Rn02_00292732 predicted 1882
7 SASI_Rn02_00292733 predicted 1239
8 SASI_Rn02_00292734 predicted 1114
9 SASI_Rn02_00292735 predicted 3604
10 SASI_Rn02_00292736 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292913 predicted 3273
2 SASI_Rn02_00292914 predicted 4010
3 SASI_Rn02_00292915 predicted 2253
4 SASI_Rn02_00292916 predicted 2511
5 SASI_Rn02_00292917 predicted 1799
6 SASI_Rn02_00292918 predicted 1203
7 SASI_Rn02_00292919 predicted 1083
8 SASI_Rn02_00292920 predicted 3522
9 SASI_Rn02_00292921 predicted 3183
10 SASI_Rn02_00292922 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293066 predicted 3409
2 SASI_Rn02_00293067 predicted 2808
3 SASI_Rn02_00293068 predicted 4151
4 SASI_Rn02_00293069 predicted 2401
5 SASI_Rn02_00293070 predicted 2652
6 SASI_Rn02_00293071 predicted 1941
7 SASI_Rn02_00293072 predicted 1350
8 SASI_Rn02_00293073 predicted 1225
9 SASI_Rn02_00293074 predicted 3664
10 SASI_Rn02_00293075 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293285 predicted 3370
2 SASI_Rn02_00293286 predicted 4107
3 SASI_Rn02_00293287 predicted 2357
4 SASI_Rn02_00293288 predicted 2606
5 SASI_Rn02_00293289 predicted 1901
6 SASI_Rn02_00293290 predicted 1304
7 SASI_Rn02_00293291 predicted 1075
8 SASI_Rn02_00293292 predicted 3619
9 SASI_Rn02_00293293 predicted 3276
10 SASI_Rn02_00293294 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293499 predicted 3309
2 SASI_Rn02_00293500 predicted 4045
3 SASI_Rn02_00293501 predicted 2296
4 SASI_Rn02_00293502 predicted 3976
5 SASI_Rn02_00293503 predicted 2547
6 SASI_Rn02_00293504 predicted 1839
7 SASI_Rn02_00293505 predicted 1238
8 SASI_Rn02_00293506 predicted 1111
9 SASI_Rn02_00293507 predicted 3555
10 SASI_Rn02_00293508 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293664 predicted 3405
2 SASI_Rn02_00293665 predicted 4145
3 SASI_Rn02_00293666 predicted 2384
4 SASI_Rn02_00293667 predicted 2640
5 SASI_Rn02_00293668 predicted 1934
6 SASI_Rn02_00293669 predicted 1341
7 SASI_Rn02_00293670 predicted 1116
8 SASI_Rn02_00293671 predicted 3649
9 SASI_Rn02_00293672 predicted 3312
10 SASI_Rn02_00293673 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391584 predicted 3417
2 SASI_Rn02_00391585 predicted 2811
3 SASI_Rn02_00391586 predicted 4151
4 SASI_Rn02_00391587 predicted 2399
5 SASI_Rn02_00391588 predicted 2652
6 SASI_Rn02_00391589 predicted 1946
7 SASI_Rn02_00391590 predicted 1305
8 SASI_Rn02_00391591 predicted 1082
9 SASI_Rn02_00391592 predicted 3655
10 SASI_Rn02_00391593 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296647 predicted 549
2 SASI_Mm02_00296648 predicted 1698
3 SASI_Mm02_00296649 predicted 1285
4 SASI_Mm02_00296650 predicted 1485
5 SASI_Mm02_00296651 predicted 2434
6 SASI_Mm02_00296652 predicted 1200
7 SASI_Mm02_00296653 predicted 3688
8 SASI_Mm02_00296654 predicted 949
9 SASI_Mm02_00296655 predicted 3886
10 SASI_Mm02_00296656 predicted 4194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226640 predicted 4366
2 SASI_Mm01_00226641 predicted 5299
3 SASI_Mm01_00226642 predicted 5365
4 SASI_Mm01_00226643 predicted 5244
5 SASI_Mm01_00226644 predicted 4285
6 SASI_Mm01_00226645 predicted 4139
7 SASI_Mm01_00226646 predicted 4198
8 SASI_Mm01_00226647 predicted 4118
9 SASI_Mm01_00226648 predicted 5391
10 SASI_Mm01_00226649 predicted 5222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239312 predicted 4315
2 SASI_Mm01_00239313 predicted 5250
3 SASI_Mm01_00239314 predicted 5327
4 SASI_Mm01_00239315 predicted 5200
5 SASI_Mm01_00239316 predicted 4240
6 SASI_Mm01_00239317 predicted 4087
7 SASI_Mm01_00239318 predicted 4152
8 SASI_Mm01_00239319 predicted 4075
9 SASI_Mm01_00239320 predicted 5344
10 SASI_Mm01_00239321 predicted 5184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214392 predicted 2223
2 SASI_Mm01_00214393 predicted 2533
3 SASI_Mm01_00214394 predicted 2294
4 SASI_Mm01_00214395 predicted 2392
5 SASI_Mm01_00214396 predicted 2034
6 SASI_Mm01_00214397 predicted 2283
7 SASI_Mm01_00214398 predicted 2200
8 SASI_Mm01_00214399 predicted 2045
9 SASI_Mm01_00214400 predicted 2350
10 SASI_Mm01_00214401 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284860 predicted 780
2 SASI_Mm01_00284861 predicted 1027
3 SASI_Mm01_00284862 predicted 910
4 SASI_Mm01_00284863 predicted 926
5 SASI_Mm01_00284864 predicted 868
6 SASI_Mm01_00284865 predicted 1056
7 SASI_Mm01_00284866 predicted 988
8 SASI_Mm01_00284867 predicted 945
9 SASI_Mm01_00284868 predicted 828
10 SASI_Mm01_00284869 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222399 predicted 4263
2 SASI_Mm01_00222400 predicted 5197
3 SASI_Mm01_00222401 predicted 5274
4 SASI_Mm01_00222402 predicted 5146
5 SASI_Mm01_00222403 predicted 4189
6 SASI_Mm01_00222404 predicted 4034
7 SASI_Mm01_00222405 predicted 4098
8 SASI_Mm01_00222406 predicted 4025
9 SASI_Mm01_00222407 predicted 5297
10 SASI_Mm01_00222408 predicted 5126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261073 predicted 4159
2 SASI_Mm01_00261074 predicted 5088
3 SASI_Mm01_00261075 predicted 5163
4 SASI_Mm01_00261076 predicted 5037
5 SASI_Mm01_00261077 predicted 4074
6 SASI_Mm01_00261078 predicted 3927
7 SASI_Mm01_00261079 predicted 3983
8 SASI_Mm01_00261080 predicted 3911
9 SASI_Mm01_00261081 predicted 5176
10 SASI_Mm01_00261082 predicted 5018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208952 predicted 4318
2 SASI_Mm01_00208953 predicted 5246
3 SASI_Mm01_00208954 predicted 5316
4 SASI_Mm01_00208955 predicted 5196
5 SASI_Mm01_00208956 predicted 4231
6 SASI_Mm01_00208957 predicted 4084
7 SASI_Mm01_00208958 predicted 4145
8 SASI_Mm01_00208959 predicted 4080
9 SASI_Mm01_00208960 predicted 5337
10 SASI_Mm01_00208961 predicted 5180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251120 predicted 2318
2 SASI_Mm01_00251121 predicted 2620
3 SASI_Mm01_00251122 predicted 2396
4 SASI_Mm01_00251123 predicted 2488
5 SASI_Mm01_00251124 predicted 2134
6 SASI_Mm01_00251125 predicted 2385
7 SASI_Mm01_00251126 predicted 2289
8 SASI_Mm01_00251127 predicted 2149
9 SASI_Mm01_00251128 predicted 2447
10 SASI_Mm01_00251129 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223092 predicted 2309
2 SASI_Mm01_00223093 predicted 2622
3 SASI_Mm01_00223094 predicted 2391
4 SASI_Mm01_00223095 predicted 2485
5 SASI_Mm01_00223096 predicted 2130
6 SASI_Mm01_00223097 predicted 2384
7 SASI_Mm01_00223098 predicted 2295
8 SASI_Mm01_00223099 predicted 2142
9 SASI_Mm01_00223100 predicted 2443
10 SASI_Mm01_00223101 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253881 predicted 2221
2 SASI_Mm01_00253882 predicted 2533
3 SASI_Mm01_00253883 predicted 2302
4 SASI_Mm01_00253884 predicted 2392
5 SASI_Mm01_00253885 predicted 2029
6 SASI_Mm01_00253886 predicted 2289
7 SASI_Mm01_00253887 predicted 2200
8 SASI_Mm01_00253888 predicted 2047
9 SASI_Mm01_00253889 predicted 2344
10 SASI_Mm01_00253890 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279300 predicted 4228
2 SASI_Mm01_00279301 predicted 4937
3 SASI_Mm01_00279302 predicted 4142
4 SASI_Mm01_00279303 predicted 3996
5 SASI_Mm01_00279304 predicted 4052
6 SASI_Mm01_00279305 predicted 3983
7 SASI_Mm01_00279306 predicted 4363
8 SASI_Mm01_00279307 predicted 4335
9 SASI_Mm01_00279308 predicted 5078
10 SASI_Mm01_00279309 predicted 4488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234374 predicted 4218
2 SASI_Mm01_00234375 predicted 5159
3 SASI_Mm01_00234376 predicted 5231
4 SASI_Mm01_00234377 predicted 5104
5 SASI_Mm01_00234378 predicted 4134
6 SASI_Mm01_00234379 predicted 3995
7 SASI_Mm01_00234380 predicted 4051
8 SASI_Mm01_00234381 predicted 3983
9 SASI_Mm01_00234382 predicted 5249
10 SASI_Mm01_00234383 predicted 5087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081251
PBRM1 MISSION shRNA Bacterial Glycerol Stock
polybromo 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081251.1-5848s21c1
Sequence:CCGGTGTGAAGTTGGTCCTAGTTTACTCGAGTAAACTAGGACCAACTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-954s21c1
Sequence:CCGGGTGCAATATCCAGACTATTATCTCGAGATAATAGTCTGGATATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5262s21c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5397s21c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-2920s21c1
Sequence:CCGGACCGGACAGATTCCGAAATATCTCGAGATATTTCGGAATCTGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081251
PBRM1 MISSION shRNA shRNA Plasmid DNA
polybromo 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081251.1-5848s21c1
Sequence:CCGGTGTGAAGTTGGTCCTAGTTTACTCGAGTAAACTAGGACCAACTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-954s21c1
Sequence:CCGGGTGCAATATCCAGACTATTATCTCGAGATAATAGTCTGGATATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5262s21c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5397s21c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-2920s21c1
Sequence:CCGGACCGGACAGATTCCGAAATATCTCGAGATATTTCGGAATCTGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081251
PBRM1 MISSION shRNA Lentiviral Transduction Particles
polybromo 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081251.1-5848s21c1
Sequence:CCGGTGTGAAGTTGGTCCTAGTTTACTCGAGTAAACTAGGACCAACTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-954s21c1
Sequence:CCGGGTGCAATATCCAGACTATTATCTCGAGATAATAGTCTGGATATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5262s21c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-5397s21c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081251.1-2920s21c1
Sequence:CCGGACCGGACAGATTCCGAAATATCTCGAGATATTTCGGAATCTGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018165
VALIDATED
PBRM1 MISSION shRNA Bacterial Glycerol Stock
polybromo 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1998s21c1
Sequence:CCGGTGACTACTATCTGACTATTAACTCGAGTTAATAGTCAGATAGTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1698s21c1
Sequence:CCGGCCGGAATGCCAGGCACTATAACTCGAGTTATAGTGCCTGGCATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018165.4-6887s21c1
Sequence:CCGGTCACTAGACAGGCCCTAATTACTCGAGTAATTAGGGCCTGTCTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1092s21c1
Sequence:CCGGAGTTAGGAGTTGTCGGAATAACTCGAGTTATTCCGACAACTCCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-1158s1c1
Sequence:CCGGCCCTGATTATTACCAGCAAATCTCGAGATTTGCTGGTAATAATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-2412s21c1
Sequence:CCGGTCGCTACCGTCGGCTTGATTTCTCGAGAAATCAAGCCGACGGTAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-2128s1c1
Sequence:CCGGCCGGAGTCTTTGATCTACAAACTCGAGTTTGTAGATCAAAGACTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-3487s1c1
Sequence:CCGGCCCATCTTCATTCACCCAGAACTCGAGTTCTGGGTGAATGAAGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-247s1c1
Sequence:CCGGCCAGACTATTATGAAGTGGTTCTCGAGAACCACTTCATAATAGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-1335s1c1
Sequence:CCGGGCAGCAAGTTATGCAGGCAAACTCGAGTTTGCCTGCATAACTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018165
VALIDATED
PBRM1 MISSION shRNA shRNA Plasmid DNA
polybromo 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1998s21c1
Sequence:CCGGTGACTACTATCTGACTATTAACTCGAGTTAATAGTCAGATAGTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1698s21c1
Sequence:CCGGCCGGAATGCCAGGCACTATAACTCGAGTTATAGTGCCTGGCATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018165.4-6887s21c1
Sequence:CCGGTCACTAGACAGGCCCTAATTACTCGAGTAATTAGGGCCTGTCTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1092s21c1
Sequence:CCGGAGTTAGGAGTTGTCGGAATAACTCGAGTTATTCCGACAACTCCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-1158s1c1
Sequence:CCGGCCCTGATTATTACCAGCAAATCTCGAGATTTGCTGGTAATAATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-2412s21c1
Sequence:CCGGTCGCTACCGTCGGCTTGATTTCTCGAGAAATCAAGCCGACGGTAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-2128s1c1
Sequence:CCGGCCGGAGTCTTTGATCTACAAACTCGAGTTTGTAGATCAAAGACTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-3487s1c1
Sequence:CCGGCCCATCTTCATTCACCCAGAACTCGAGTTCTGGGTGAATGAAGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-247s1c1
Sequence:CCGGCCAGACTATTATGAAGTGGTTCTCGAGAACCACTTCATAATAGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-1335s1c1
Sequence:CCGGGCAGCAAGTTATGCAGGCAAACTCGAGTTTGCCTGCATAACTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018165
VALIDATED
PBRM1 MISSION shRNA Lentiviral Transduction Particles
polybromo 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1998s21c1
Sequence:CCGGTGACTACTATCTGACTATTAACTCGAGTTAATAGTCAGATAGTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1698s21c1
Sequence:CCGGCCGGAATGCCAGGCACTATAACTCGAGTTATAGTGCCTGGCATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018165.4-6887s21c1
Sequence:CCGGTCACTAGACAGGCCCTAATTACTCGAGTAATTAGGGCCTGTCTAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-1092s21c1
Sequence:CCGGAGTTAGGAGTTGTCGGAATAACTCGAGTTATTCCGACAACTCCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-1158s1c1
Sequence:CCGGCCCTGATTATTACCAGCAAATCTCGAGATTTGCTGGTAATAATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018165.4-2412s21c1
Sequence:CCGGTCGCTACCGTCGGCTTGATTTCTCGAGAAATCAAGCCGACGGTAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018165.2-2128s1c1
Sequence:CCGGCCGGAGTCTTTGATCTACAAACTCGAGTTTGTAGATCAAAGACTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-3487s1c1
Sequence:CCGGCCCATCTTCATTCACCCAGAACTCGAGTTCTGGGTGAATGAAGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-247s1c1
Sequence:CCGGCCAGACTATTATGAAGTGGTTCTCGAGAACCACTTCATAATAGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018165.2-1335s1c1
Sequence:CCGGGCAGCAAGTTATGCAGGCAAACTCGAGTTTGCCTGCATAACTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025847
VALIDATED
PBRM1 MISSION shRNA Bacterial Glycerol Stock
polybromo 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025847.1-1683s1c1
Sequence:CCGGGCGGCATATTTGCTCTATTAACTCGAGTTAATAGAGCAAATATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-159s1c1
Sequence:CCGGCCGCTATAATGAGAGTGACAACTCGAGTTGTCACTCTCATTATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-967s1c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025847.1-1102s1c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-220s1c1
Sequence:CCGGTCTGCTAAAGTTGTAGATGATCTCGAGATCATCTACAACTTTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025847
VALIDATED
PBRM1 MISSION shRNA shRNA Plasmid DNA
polybromo 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025847.1-1683s1c1
Sequence:CCGGGCGGCATATTTGCTCTATTAACTCGAGTTAATAGAGCAAATATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-159s1c1
Sequence:CCGGCCGCTATAATGAGAGTGACAACTCGAGTTGTCACTCTCATTATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-967s1c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025847.1-1102s1c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-220s1c1
Sequence:CCGGTCTGCTAAAGTTGTAGATGATCTCGAGATCATCTACAACTTTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025847
VALIDATED
PBRM1 MISSION shRNA Lentiviral Transduction Particles
polybromo 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025847.1-1683s1c1
Sequence:CCGGGCGGCATATTTGCTCTATTAACTCGAGTTAATAGAGCAAATATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-159s1c1
Sequence:CCGGCCGCTATAATGAGAGTGACAACTCGAGTTGTCACTCTCATTATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-967s1c1
Sequence:CCGGCGGGATGTCCATTTGTCCAAACTCGAGTTTGGACAAATGGACATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025847.1-1102s1c1
Sequence:CCGGCGACAGGCATACAACCTAGAACTCGAGTTCTAGGTTGTATGCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025847.1-220s1c1
Sequence:CCGGTCTGCTAAAGTTGTAGATGATCTCGAGATCATCTACAACTTTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)