EMAIL THIS PAGE TO A FRIEND

PBX1

pre-B-cell leukemia homeobox 1

116 Gene Product Result for
UniProtKB ID: P40424, B4DSC1, F5H4U9, Q5T488
Gene ID:
Human(5087) Summary: This gene encodes a nuclear protein that belongs to the PBX homeobox family of transcriptional factors. Studies in mice suggest that this gene may be involved in the regulation of osteogenesis, and required for skeletal patterning and programming. A chromosomal translocation, t(1;19) involving this gene and TCF3/E2A gene, is associated with pre-B-cell acute lymphoblastic leukemia. The resulting fusion protein, in which the DNA binding domain of E2A is replaced by the DNA binding domain of this protein, transforms cells by constitutively activating transcription of genes regulated by the PBX protein family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(18514) pre B cell leukemia homeobox 1
Rat(304947) pre-B-cell leukemia homeobox 1
sheep(101108880) pre-B-cell leukemia homeobox 1
Domestic Rabbit(100341186) pre-B-cell leukemia homeobox 1
naked mole-rat(101714961) pre-B-cell leukemia homeobox 1
domestic guinea pig(100723723) pre-B-cell leukemia homeobox 1
chicken(395505) pre-B-cell leukemia homeobox 1
domestic cat(101081781) pre-B-cell leukemia homeobox 1
Horse(100058426) pre-B-cell leukemia homeobox 1
cow(540688) pre-B-cell leukemia homeobox 1
dog(488669) pre-B-cell leukemia homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002585 Rosetta Predictions human pricing
NM_001134862 Rosetta Predictions rat pricing
XM_001072172 Rosetta Predictions rat pricing
XM_001072218 Rosetta Predictions rat pricing
XM_001072250 Rosetta Predictions rat pricing
NM_008783 Rosetta Predictions mouse pricing
NM_183355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154081 predicted 1230
2 SASI_Hs01_00154082 predicted 229
3 SASI_Hs01_00154083 predicted 1023
4 SASI_Hs01_00154084 predicted 1150
5 SASI_Hs01_00154085 predicted 953
6 SASI_Hs01_00154088 predicted 1228
7 SASI_Hs01_00154089 predicted 968
8 SASI_Hs01_00154090 predicted 791
9 SASI_Hs02_00334083 predicted 965
10 SASI_Hs02_00334084 predicted 1049
11 SASI_Hs01_00154086 predicted 837
12 SASI_Hs01_00154087 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258824 predicted 882
2 SASI_Rn02_00258825 predicted 621
3 SASI_Rn02_00258826 predicted 1451
4 SASI_Rn02_00258827 predicted 654
5 SASI_Rn02_00258828 predicted 1150
6 SASI_Rn02_00258829 predicted 707
7 SASI_Rn02_00258830 predicted 1390
8 SASI_Rn02_00258831 predicted 600
9 SASI_Rn02_00258832 predicted 1713
10 SASI_Rn02_00258833 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338100 predicted 900
2 SASI_Rn02_00338101 predicted 643
3 SASI_Rn02_00338102 predicted 669
4 SASI_Rn02_00338103 predicted 879
5 SASI_Rn02_00338104 predicted 597
6 SASI_Rn02_00338105 predicted 1167
7 SASI_Rn02_00338106 predicted 601
8 SASI_Rn02_00338107 predicted 720
9 SASI_Rn02_00338108 predicted 1148
10 SASI_Rn02_00338109 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338271 predicted 896
2 SASI_Rn02_00338272 predicted 641
3 SASI_Rn02_00338273 predicted 1466
4 SASI_Rn02_00338274 predicted 672
5 SASI_Rn02_00338275 predicted 1167
6 SASI_Rn02_00338276 predicted 729
7 SASI_Rn02_00338277 predicted 1407
8 SASI_Rn02_00338278 predicted 609
9 SASI_Rn02_00338279 predicted 1701
10 SASI_Rn02_00338280 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338405 predicted 894
2 SASI_Rn02_00338406 predicted 640
3 SASI_Rn02_00338407 predicted 1473
4 SASI_Rn02_00338408 predicted 672
5 SASI_Rn02_00338409 predicted 1166
6 SASI_Rn02_00338410 predicted 723
7 SASI_Rn02_00338411 predicted 1401
8 SASI_Rn02_00338412 predicted 612
9 SASI_Rn02_00338413 predicted 1729
10 SASI_Rn02_00338414 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042864 predicted 951
2 SASI_Mm01_00042865 predicted 975
3 SASI_Mm02_00314681 predicted 1204
4 SASI_Mm01_00042866 predicted 903
5 SASI_Mm02_00314682 predicted 1469
6 SASI_Mm01_00042867 predicted 904
7 SASI_Mm01_00042868 predicted 1031
8 SASI_Mm01_00042869 predicted 1456
9 SASI_Mm01_00042870 predicted 920
10 SASI_Mm01_00042871 predicted 1484
11 SASI_Mm01_00042872 predicted 1024
12 SASI_Mm01_00042873 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151009 predicted 947
2 SASI_Mm01_00151010 predicted 976
3 SASI_Mm02_00350478 predicted 1205
4 SASI_Mm01_00151011 predicted 906
5 SASI_Mm02_00350479 predicted 1472
6 SASI_Mm01_00151012 predicted 911
7 SASI_Mm01_00151013 predicted 1033
8 SASI_Mm01_00151014 predicted 1462
9 SASI_Mm01_00151015 predicted 927
10 SASI_Mm01_00151016 predicted 1481
11 SASI_Mm01_00151017 predicted 796
12 SASI_Mm01_00151018 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002585
VALIDATED
PBX1 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1515s1c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-349s1c1
Sequence:CCGGGCCTTGTTTAATGTGTTGTGTCTCGAGACACAACACATTAAACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-849s1c1
Sequence:CCGGGCAAGCGACAGAAATCCTGAACTCGAGTTCAGGATTTCTGTCGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1140s1c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1316s1c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1451s21c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1651s21c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-928s21c1
Sequence:CCGGATGATCCTGCGTTCCCGATTTCTCGAGAAATCGGGAACGCAGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1275s21c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002585.2-1151s21c1
Sequence:CCGGTTCAAGAGGAAGCCAATATTTCTCGAGAAATATTGGCTTCCTCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002585
VALIDATED
PBX1 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1515s1c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-349s1c1
Sequence:CCGGGCCTTGTTTAATGTGTTGTGTCTCGAGACACAACACATTAAACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-849s1c1
Sequence:CCGGGCAAGCGACAGAAATCCTGAACTCGAGTTCAGGATTTCTGTCGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1140s1c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1316s1c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1451s21c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1651s21c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-928s21c1
Sequence:CCGGATGATCCTGCGTTCCCGATTTCTCGAGAAATCGGGAACGCAGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1275s21c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002585.2-1151s21c1
Sequence:CCGGTTCAAGAGGAAGCCAATATTTCTCGAGAAATATTGGCTTCCTCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002585
VALIDATED
PBX1 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1515s1c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-349s1c1
Sequence:CCGGGCCTTGTTTAATGTGTTGTGTCTCGAGACACAACACATTAAACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002585.1-849s1c1
Sequence:CCGGGCAAGCGACAGAAATCCTGAACTCGAGTTCAGGATTTCTGTCGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1140s1c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002585.1-1316s1c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1451s21c1
Sequence:CCGGGCATCAGTGCTAATGGAGGTTCTCGAGAACCTCCATTAGCACTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1651s21c1
Sequence:CCGGCGAAGCAATCAGCAAACACAACTCGAGTTGTGTTTGCTGATTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-928s21c1
Sequence:CCGGATGATCCTGCGTTCCCGATTTCTCGAGAAATCGGGAACGCAGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002585.2-1275s21c1
Sequence:CCGGCATGTCAAACTCTGGAGATTTCTCGAGAAATCTCCAGAGTTTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002585.2-1151s21c1
Sequence:CCGGTTCAAGAGGAAGCCAATATTTCTCGAGAAATATTGGCTTCCTCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008783
VALIDATED
PBX1 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-1036s1c1
Sequence:CCGGCTCACAGATCAGACAAATCTACTCGAGTAGATTTGTCTGATCTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1276s1c1
Sequence:CCGGGCGGAAGAGACGGAATTTCAACTCGAGTTGAAATTCCGTCTCTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-796s1c1
Sequence:CCGGGCCTGCCTTGTTTAATGTGTTCTCGAGAACACATTAAACAAGGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1478s1c1
Sequence:CCGGGCCAATATTTATGCTGCCAAACTCGAGTTTGGCAGCATAAATATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008783.1-2445s1c1
Sequence:CCGGGCCCATTGATTGGTTTGGAAACTCGAGTTTCCAAACCAATCAATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008783
VALIDATED
PBX1 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-1036s1c1
Sequence:CCGGCTCACAGATCAGACAAATCTACTCGAGTAGATTTGTCTGATCTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1276s1c1
Sequence:CCGGGCGGAAGAGACGGAATTTCAACTCGAGTTGAAATTCCGTCTCTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-796s1c1
Sequence:CCGGGCCTGCCTTGTTTAATGTGTTCTCGAGAACACATTAAACAAGGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1478s1c1
Sequence:CCGGGCCAATATTTATGCTGCCAAACTCGAGTTTGGCAGCATAAATATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008783.1-2445s1c1
Sequence:CCGGGCCCATTGATTGGTTTGGAAACTCGAGTTTCCAAACCAATCAATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008783
VALIDATED
PBX1 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-1036s1c1
Sequence:CCGGCTCACAGATCAGACAAATCTACTCGAGTAGATTTGTCTGATCTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1276s1c1
Sequence:CCGGGCGGAAGAGACGGAATTTCAACTCGAGTTGAAATTCCGTCTCTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008783.1-796s1c1
Sequence:CCGGGCCTGCCTTGTTTAATGTGTTCTCGAGAACACATTAAACAAGGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008783.1-1478s1c1
Sequence:CCGGGCCAATATTTATGCTGCCAAACTCGAGTTTGGCAGCATAAATATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008783.1-2445s1c1
Sequence:CCGGGCCCATTGATTGGTTTGGAAACTCGAGTTTCCAAACCAATCAATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)