EMAIL THIS PAGE TO A FRIEND

PBX2

pre-B-cell leukemia homeobox 2

145 Gene Product Result for
Synonyms: G17 HOX12 PBX2MHC
UniProtKB ID: P40425, A2BFJ2
Gene ID:
Human(5089) Summary: This gene encodes a ubiquitously expressed member of the TALE/PBX homeobox family. It was identified by its similarity to a homeobox gene which is involved in t(1;19) translocation in acute pre-B-cell leukemias. This protein is a transcriptional activator which binds to the TLX1 promoter. The gene is located within the major histocompatibility complex (MHC) on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(18515) pre B cell leukemia homeobox 2
Rat(406164) pre-B-cell leukemia homeobox 2
Zebrafish(58136) pre-B-cell leukemia transcription factor 2
domestic cat(101097316) pre-B-cell leukemia homeobox 2
cow(100139739) pre-B-cell leukemia homeobox 2
dog(607695) pre-B-cell leukemia homeobox 2
domestic guinea pig(100713120) pre-B-cell leukemia homeobox 2
naked mole-rat(101706979) pre-B-cell leukemia homeobox 2
sheep(101122392) pre-B-cell leukemia homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA061478 Anti-PBX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002586 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043991 MISSION® esiRNA esiRNA targeting mouse Pbx2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002586 Rosetta Predictions human pricing
NM_001002828 Rosetta Predictions rat pricing
NM_017463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024556 predicted 1041
2 SASI_Hs01_00024557 predicted 725
3 SASI_Hs01_00024558 predicted 1160
4 SASI_Hs01_00024559 predicted 1828
5 SASI_Hs01_00024560 predicted 1153
6 SASI_Hs01_00024561 predicted 1003
7 SASI_Hs01_00024562 predicted 818
8 SASI_Hs01_00024563 predicted 1642
9 SASI_Hs01_00024564 predicted 1444
10 SASI_Hs01_00024565 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074146 predicted 1602
2 SASI_Rn01_00074147 predicted 1002
3 SASI_Rn01_00074148 predicted 1593
4 SASI_Rn01_00074149 predicted 969
5 SASI_Rn01_00074150 predicted 625
6 SASI_Rn01_00074151 predicted 1601
7 SASI_Rn01_00074152 predicted 1251
8 SASI_Rn01_00074153 predicted 537
9 SASI_Rn01_00074154 predicted 1251
10 SASI_Rn01_00074155 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137064 predicted 1633
2 SASI_Mm01_00137065 predicted 962
3 SASI_Mm01_00137066 predicted 1605
4 SASI_Mm01_00137067 predicted 1595
5 SASI_Mm01_00137068 predicted 946
6 SASI_Mm01_00137069 predicted 714
7 SASI_Mm01_00137070 predicted 306
8 SASI_Mm01_00137071 predicted 295
9 SASI_Mm01_00137072 predicted 1251
10 SASI_Mm01_00137073 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017463
VALIDATED
PBX2 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-635s21c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-353s21c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-729s21c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017463.1-1688s1c1
Sequence:CCGGCCCACTTATATACTCTGGAATCTCGAGATTCCAGAGTATATAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017463.1-355s1c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-731s1c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-329s1c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-637s1c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-327s21c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017463
VALIDATED
PBX2 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-635s21c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-353s21c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-729s21c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017463.1-1688s1c1
Sequence:CCGGCCCACTTATATACTCTGGAATCTCGAGATTCCAGAGTATATAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017463.1-355s1c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-731s1c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-329s1c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-637s1c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-327s21c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017463
VALIDATED
PBX2 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-635s21c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-353s21c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-729s21c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017463.1-1688s1c1
Sequence:CCGGCCCACTTATATACTCTGGAATCTCGAGATTCCAGAGTATATAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017463.1-355s1c1
Sequence:CCGGCCTGTGTGAAATCAAGGAGAACTCGAGTTCTCCTTGATTTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-731s1c1
Sequence:CCGGCATCGAAAGTTCAGCGCCATTCTCGAGAATGGCGCTGAACTTTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-329s1c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017463.1-637s1c1
Sequence:CCGGTGAGTTCACAACTCACGTCATCTCGAGATGACGTGAGTTGTGAACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017463.2-327s21c1
Sequence:CCGGCGAATGAAACCTGCCCTGTTTCTCGAGAAACAGGGCAGGTTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002586
VALIDATED
PBX2 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1908s21c1
Sequence:CCGGATACTCCCACTTGCAACTATTCTCGAGAATAGTTGCAAGTGGGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1159s21c1
Sequence:CCGGCAACAAGAGGATTCGCTATAACTCGAGTTATAGCGAATCCTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1038s21c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002586.4-734s21c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002586.3-1968s1c1
Sequence:CCGGCCCACTTGTATGCTCTGGAATCTCGAGATTCCAGAGCATACAAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-734s1c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-499s1c1
Sequence:CCGGCGCCCTAAACTGCCACCGAATCTCGAGATTCGGTGGCAGTTTAGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-1038s1c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-765s21c1
Sequence:CCGGTTGCCCAGATCCGTCACATATCTCGAGATATGTGACGGATCTGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002586.3-1305s1c1
Sequence:CCGGGCTCTTTCAATCTCTCAGGATCTCGAGATCCTGAGAGATTGAAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002586
VALIDATED
PBX2 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1908s21c1
Sequence:CCGGATACTCCCACTTGCAACTATTCTCGAGAATAGTTGCAAGTGGGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1159s21c1
Sequence:CCGGCAACAAGAGGATTCGCTATAACTCGAGTTATAGCGAATCCTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1038s21c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002586.4-734s21c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002586.3-1968s1c1
Sequence:CCGGCCCACTTGTATGCTCTGGAATCTCGAGATTCCAGAGCATACAAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-734s1c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-499s1c1
Sequence:CCGGCGCCCTAAACTGCCACCGAATCTCGAGATTCGGTGGCAGTTTAGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-1038s1c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-765s21c1
Sequence:CCGGTTGCCCAGATCCGTCACATATCTCGAGATATGTGACGGATCTGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002586.3-1305s1c1
Sequence:CCGGGCTCTTTCAATCTCTCAGGATCTCGAGATCCTGAGAGATTGAAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002586
VALIDATED
PBX2 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1908s21c1
Sequence:CCGGATACTCCCACTTGCAACTATTCTCGAGAATAGTTGCAAGTGGGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1159s21c1
Sequence:CCGGCAACAAGAGGATTCGCTATAACTCGAGTTATAGCGAATCCTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-1038s21c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002586.4-734s21c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002586.3-1968s1c1
Sequence:CCGGCCCACTTGTATGCTCTGGAATCTCGAGATTCCAGAGCATACAAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-734s1c1
Sequence:CCGGTCCATCGAACACTCGGACTATCTCGAGATAGTCCGAGTGTTCGATGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-499s1c1
Sequence:CCGGCGCCCTAAACTGCCACCGAATCTCGAGATTCGGTGGCAGTTTAGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002586.3-1038s1c1
Sequence:CCGGCTGAGGTCCTAAATGAGTATTCTCGAGAATACTCATTTAGGACCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002586.4-765s21c1
Sequence:CCGGTTGCCCAGATCCGTCACATATCTCGAGATATGTGACGGATCTGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002586.3-1305s1c1
Sequence:CCGGGCTCTTTCAATCTCTCAGGATCTCGAGATCCTGAGAGATTGAAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)