EMAIL THIS PAGE TO A FRIEND

PBX3

pre-B-cell leukemia homeobox 3

210 Gene Product Result for
Gene ID:
Mouse(18516) pre B cell leukemia homeobox 3
Rat(311876) pre-B-cell leukemia homeobox 3
chicken(417093) pre-B-cell leukemia homeobox 3
dog(480723) pre-B-cell leukemia homeobox 3
domestic cat(101085840) pre-B-cell leukemia homeobox 3
cow(539222) pre-B-cell leukemia homeobox 3
sheep(101105732) pre-B-cell leukemia homeobox 3
naked mole-rat(101710079) pre-B-cell leukemia homeobox 3
domestic guinea pig(100729729) pre-B-cell leukemia homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006195 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006195 Rosetta Predictions human pricing
NM_001107834 Rosetta Predictions rat pricing
NM_016768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179270 predicted 379
2 SASI_Hs01_00179271 predicted 527
3 SASI_Hs01_00179275 predicted 586
4 SASI_Hs01_00179276 predicted 918
5 SASI_Hs02_00341083 predicted 486
6 SASI_Hs01_00179277 predicted 501
7 SASI_Hs02_00341084 predicted 783
8 SASI_Hs02_00341085 predicted 1047
9 SASI_Hs01_00179278 predicted 1255
10 SASI_Hs01_00179279 predicted 384
11 SASI_Hs01_00179272 predicted 1262
12 SASI_Hs01_00179273 predicted 491
13 SASI_Hs01_00179274 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232735 predicted 706
2 SASI_Rn02_00232736 predicted 357
3 SASI_Rn02_00232737 predicted 498
4 SASI_Rn02_00232738 predicted 1429
5 SASI_Rn02_00232739 predicted 464
6 SASI_Rn02_00232740 predicted 871
7 SASI_Rn02_00232741 predicted 557
8 SASI_Rn02_00232742 predicted 895
9 SASI_Rn02_00232743 predicted 886
10 SASI_Rn02_00232744 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041154 predicted 430
2 SASI_Mm01_00041155 predicted 1504
3 SASI_Mm01_00041156 predicted 1313
4 SASI_Mm01_00041157 predicted 630
5 SASI_Mm01_00041158 predicted 571
6 SASI_Mm02_00323532 predicted 319
7 SASI_Mm01_00041159 predicted 542
8 SASI_Mm01_00041160 predicted 947
9 SASI_Mm01_00041161 predicted 967
10 SASI_Mm01_00041162 predicted 990
11 SASI_Mm01_00041163 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016768
VALIDATED
PBX3 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1923s1c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1314s1c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-778s1c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-550s1c1
Sequence:CCGGACTCTATTGAACACTCAGATTCTCGAGAATCTGAGTGTTCAATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1400s1c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1314s21c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-778s21c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016768.1-1923s21c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1400s21c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016768
VALIDATED
PBX3 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1923s1c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1314s1c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-778s1c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-550s1c1
Sequence:CCGGACTCTATTGAACACTCAGATTCTCGAGAATCTGAGTGTTCAATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1400s1c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1314s21c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-778s21c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016768.1-1923s21c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1400s21c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016768
VALIDATED
PBX3 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1923s1c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1314s1c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-778s1c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-550s1c1
Sequence:CCGGACTCTATTGAACACTCAGATTCTCGAGAATCTGAGTGTTCAATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016768.1-1400s1c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1314s21c1
Sequence:CCGGCCACATAACTTAAACGCTAATCTCGAGATTAGCGTTTAAGTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-778s21c1
Sequence:CCGGCGTGTGAAGCAGTTATGATTTCTCGAGAAATCATAACTGCTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016768.1-1923s21c1
Sequence:CCGGGCCATCTCTTATGTTGTAATTCTCGAGAATTACAACATAAGAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016768.1-1400s21c1
Sequence:CCGGGCACTCGGATACCTCTAACTACTCGAGTAGTTAGAGGTATCCGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006195
VALIDATED
PBX3 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-2269s1c1
Sequence:CCGGGCGAACTCATACAAACCAATACTCGAGTATTGGTTTGTATGAGTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006195.2-1107s1c1
Sequence:CCGGCCACACCAAATTCCGGTTCTTCTCGAGAAGAACCGGAATTTGGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-602s1c1
Sequence:CCGGCACACAGAACTGGAGAAATATCTCGAGATATTTCTCCAGTTCTGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-976s1c1
Sequence:CCGGCAAACGAATCAGGTACAAGAACTCGAGTTCTTGTACCTGATTCGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-433s1c1
Sequence:CCGGGCTAATGAGACTGGACAATATCTCGAGATATTGTCCAGTCTCATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1718s21c1
Sequence:GTACCGGACTAAACCTCAACCGTTAAAGCTCGAGCTTTAACGGTTGAGGTTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-387s21c1
Sequence:GTACCGGAGCTAATGAGACTGGACAATACTCGAGTATTGTCCAGTCTCATTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1353s21c1
Sequence:CCGGACTCGGATACCTCTAACTAATCTCGAGATTAGTTAGAGGTATCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-488s21c1
Sequence:CCGGGGTTCTTCAGATAACTCTATTCTCGAGAATAGAGTTATCTGAAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-630s21c1
Sequence:CCGGAGAGTAGAACACGTCCCATTTCTCGAGAAATGGGACGTGTTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006195
VALIDATED
PBX3 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-2269s1c1
Sequence:CCGGGCGAACTCATACAAACCAATACTCGAGTATTGGTTTGTATGAGTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006195.2-1107s1c1
Sequence:CCGGCCACACCAAATTCCGGTTCTTCTCGAGAAGAACCGGAATTTGGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-602s1c1
Sequence:CCGGCACACAGAACTGGAGAAATATCTCGAGATATTTCTCCAGTTCTGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-976s1c1
Sequence:CCGGCAAACGAATCAGGTACAAGAACTCGAGTTCTTGTACCTGATTCGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-433s1c1
Sequence:CCGGGCTAATGAGACTGGACAATATCTCGAGATATTGTCCAGTCTCATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1718s21c1
Sequence:GTACCGGACTAAACCTCAACCGTTAAAGCTCGAGCTTTAACGGTTGAGGTTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-387s21c1
Sequence:GTACCGGAGCTAATGAGACTGGACAATACTCGAGTATTGTCCAGTCTCATTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1353s21c1
Sequence:CCGGACTCGGATACCTCTAACTAATCTCGAGATTAGTTAGAGGTATCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-488s21c1
Sequence:CCGGGGTTCTTCAGATAACTCTATTCTCGAGAATAGAGTTATCTGAAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-630s21c1
Sequence:CCGGAGAGTAGAACACGTCCCATTTCTCGAGAAATGGGACGTGTTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006195
VALIDATED
PBX3 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-2269s1c1
Sequence:CCGGGCGAACTCATACAAACCAATACTCGAGTATTGGTTTGTATGAGTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006195.2-1107s1c1
Sequence:CCGGCCACACCAAATTCCGGTTCTTCTCGAGAAGAACCGGAATTTGGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-602s1c1
Sequence:CCGGCACACAGAACTGGAGAAATATCTCGAGATATTTCTCCAGTTCTGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-976s1c1
Sequence:CCGGCAAACGAATCAGGTACAAGAACTCGAGTTCTTGTACCTGATTCGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006195.2-433s1c1
Sequence:CCGGGCTAATGAGACTGGACAATATCTCGAGATATTGTCCAGTCTCATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1718s21c1
Sequence:GTACCGGACTAAACCTCAACCGTTAAAGCTCGAGCTTTAACGGTTGAGGTTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-387s21c1
Sequence:GTACCGGAGCTAATGAGACTGGACAATACTCGAGTATTGTCCAGTCTCATTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-1353s21c1
Sequence:CCGGACTCGGATACCTCTAACTAATCTCGAGATTAGTTAGAGGTATCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-488s21c1
Sequence:CCGGGGTTCTTCAGATAACTCTATTCTCGAGAATAGAGTTATCTGAAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006195.4-630s21c1
Sequence:CCGGAGAGTAGAACACGTCCCATTTCTCGAGAAATGGGACGTGTTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)