EMAIL THIS PAGE TO A FRIEND

PBX4

pre-B-cell leukemia homeobox 4

49 Gene Product Result for
UniProtKB ID: Q9BYU1, A5D8Y0, B3KUK9
Gene ID:
Human(80714) Summary: This gene encodes a member of the pre-B cell leukemia transcription factor family. These proteins are homeobox proteins that play critical roles in embryonic development and cellular differentiation both as Hox cofactors and through Hox-independent pathways. The encoded protein contains a homeobox DNA-binding domain, but specific functions of the protein have not been determined. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011]
Mouse(80720) pre B cell leukemia homeobox 4
Rat(361131) pre-B-cell leukemia homeobox 4
Zebrafish(30728) pre-B-cell leukemia transcription factor 4
cow(519770) pre-B-cell leukemia homeobox 4
domestic cat(101091514) pre-B-cell leukemia homeobox 4
dog(609679) pre-B-cell leukemia homeobox 4
chicken(426087) pre-B-cell leukemia homeobox 4
sheep(101104316) pre-B-cell leukemia homeobox 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002761 MISSION® esiRNA esiRNA targeting human PBX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025245 Rosetta Predictions human pricing
NM_001108399 Rosetta Predictions rat pricing
NM_001024954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067008 predicted 1104
2 SASI_Hs01_00067009 predicted 662
3 SASI_Hs01_00067010 predicted 749
4 SASI_Hs01_00067011 predicted 829
5 SASI_Hs02_00358072 predicted 1097
6 SASI_Hs02_00358073 predicted 661
7 SASI_Hs02_00358074 predicted 663
8 SASI_Hs01_00067014 predicted 534
9 SASI_Hs02_00358075 predicted 747
10 SASI_Hs02_00358076 predicted 826
11 SASI_Hs01_00067012 predicted 414
12 SASI_Hs01_00067013 predicted 352
13 SASI_Hs01_00067015 predicted 393
14 SASI_Hs01_00067016 predicted 449
15 SASI_Hs01_00067017 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238279 predicted 290
2 SASI_Rn02_00238280 predicted 1152
3 SASI_Rn02_00238281 predicted 785
4 SASI_Rn02_00238282 predicted 820
5 SASI_Rn02_00238283 predicted 452
6 SASI_Rn02_00238284 predicted 913
7 SASI_Rn02_00238285 predicted 513
8 SASI_Rn02_00238286 predicted 447
9 SASI_Rn02_00238287 predicted 394
10 SASI_Rn02_00238288 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162035 predicted 263
2 SASI_Mm01_00162036 predicted 421
3 SASI_Mm01_00162038 predicted 688
4 SASI_Mm01_00162039 predicted 488
5 SASI_Mm01_00162040 predicted 460
6 SASI_Mm01_00162041 predicted 297
7 SASI_Mm01_00162042 predicted 848
8 SASI_Mm01_00162043 predicted 521
9 SASI_Mm01_00162044 predicted 867
10 SASI_Mm02_00287759 predicted 478
11 SASI_Mm01_00162037 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024954
PBX4 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 4
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000436599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-687s21c1
Sequence:CCGGGACGTGCTGAATGAATATTTCCTCGAGGAAATATTCATTCAGCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-354s21c1
Sequence:CCGGACACCAGGTGGCTGTCCAAATCTCGAGATTTGGACAGCCACCTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-1121s21c1
Sequence:CCGGTTGGGATGCTGCATCTAATTACTCGAGTAATTAGATGCAGCATCCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024954
PBX4 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 4
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000436599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-687s21c1
Sequence:CCGGGACGTGCTGAATGAATATTTCCTCGAGGAAATATTCATTCAGCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-354s21c1
Sequence:CCGGACACCAGGTGGCTGTCCAAATCTCGAGATTTGGACAGCCACCTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-1121s21c1
Sequence:CCGGTTGGGATGCTGCATCTAATTACTCGAGTAATTAGATGCAGCATCCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024954
PBX4 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 4
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000436599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-687s21c1
Sequence:CCGGGACGTGCTGAATGAATATTTCCTCGAGGAAATATTCATTCAGCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-354s21c1
Sequence:CCGGACACCAGGTGGCTGTCCAAATCTCGAGATTTGGACAGCCACCTGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024954.1-1121s21c1
Sequence:CCGGTTGGGATGCTGCATCTAATTACTCGAGTAATTAGATGCAGCATCCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025245
PBX4 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025245.1-164s21c1
Sequence:CCGGAGCGTGCTCTGTGAGATCAAGCTCGAGCTTGATCTCACAGAGCACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025245.1-1168s21c1
Sequence:CCGGTGTATCGCCAGCCGTTGCTTTCTCGAGAAAGCAACGGCTGGCGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-836s1c1
Sequence:CCGGGCTACCATTTACACGGGTAAACTCGAGTTTACCCGTGTAAATGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-116s1c1
Sequence:CCGGGCCAGAAAGCATGCTCTGAATCTCGAGATTCAGAGCATGCTTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-206s1c1
Sequence:CCGGCGTGGCATTCAAGACGAAGATCTCGAGATCTTCGTCTTGAATGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-1098s1c1
Sequence:CCGGGCAGCATCAACTCCAGTACATCTCGAGATGTACTGGAGTTGATGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-347s1c1
Sequence:CCGGTGTCCAAATGACAATAGCATTCTCGAGAATGCTATTGTCATTTGGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025245
PBX4 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025245.1-164s21c1
Sequence:CCGGAGCGTGCTCTGTGAGATCAAGCTCGAGCTTGATCTCACAGAGCACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025245.1-1168s21c1
Sequence:CCGGTGTATCGCCAGCCGTTGCTTTCTCGAGAAAGCAACGGCTGGCGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-836s1c1
Sequence:CCGGGCTACCATTTACACGGGTAAACTCGAGTTTACCCGTGTAAATGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-116s1c1
Sequence:CCGGGCCAGAAAGCATGCTCTGAATCTCGAGATTCAGAGCATGCTTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-206s1c1
Sequence:CCGGCGTGGCATTCAAGACGAAGATCTCGAGATCTTCGTCTTGAATGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-1098s1c1
Sequence:CCGGGCAGCATCAACTCCAGTACATCTCGAGATGTACTGGAGTTGATGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-347s1c1
Sequence:CCGGTGTCCAAATGACAATAGCATTCTCGAGAATGCTATTGTCATTTGGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025245
PBX4 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025245.1-164s21c1
Sequence:CCGGAGCGTGCTCTGTGAGATCAAGCTCGAGCTTGATCTCACAGAGCACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025245.1-1168s21c1
Sequence:CCGGTGTATCGCCAGCCGTTGCTTTCTCGAGAAAGCAACGGCTGGCGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-836s1c1
Sequence:CCGGGCTACCATTTACACGGGTAAACTCGAGTTTACCCGTGTAAATGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-116s1c1
Sequence:CCGGGCCAGAAAGCATGCTCTGAATCTCGAGATTCAGAGCATGCTTTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-206s1c1
Sequence:CCGGCGTGGCATTCAAGACGAAGATCTCGAGATCTTCGTCTTGAATGCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-1098s1c1
Sequence:CCGGGCAGCATCAACTCCAGTACATCTCGAGATGTACTGGAGTTGATGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025245.1-347s1c1
Sequence:CCGGTGTCCAAATGACAATAGCATTCTCGAGAATGCTATTGTCATTTGGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030555
PBX4 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030555.1-268s1c1
Sequence:CCGGACAGGGAAGTTTCAGGAAGAACTCGAGTTCTTCCTGAAACTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-191s1c1
Sequence:CCGGCAGTGTGCTCTGCGAGATCAACTCGAGTTGATCTCGCAGAGCACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-53s1c1
Sequence:CCGGCCTGCCGACCACAGCTCCACTCTCGAGAGTGGAGCTGTGGTCGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-77s1c1
Sequence:CCGGCCATGACACGAGCGACGTCCTCTCGAGAGGACGTCGCTCGTGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-160s1c1
Sequence:CCGGTGAACTGCCATCGGATGAAGTCTCGAGACTTCATCCGATGGCAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030555
PBX4 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030555.1-268s1c1
Sequence:CCGGACAGGGAAGTTTCAGGAAGAACTCGAGTTCTTCCTGAAACTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-191s1c1
Sequence:CCGGCAGTGTGCTCTGCGAGATCAACTCGAGTTGATCTCGCAGAGCACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-53s1c1
Sequence:CCGGCCTGCCGACCACAGCTCCACTCTCGAGAGTGGAGCTGTGGTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-77s1c1
Sequence:CCGGCCATGACACGAGCGACGTCCTCTCGAGAGGACGTCGCTCGTGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-160s1c1
Sequence:CCGGTGAACTGCCATCGGATGAAGTCTCGAGACTTCATCCGATGGCAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030555
PBX4 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030555.1-268s1c1
Sequence:CCGGACAGGGAAGTTTCAGGAAGAACTCGAGTTCTTCCTGAAACTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-191s1c1
Sequence:CCGGCAGTGTGCTCTGCGAGATCAACTCGAGTTGATCTCGCAGAGCACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-53s1c1
Sequence:CCGGCCTGCCGACCACAGCTCCACTCTCGAGAGTGGAGCTGTGGTCGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-77s1c1
Sequence:CCGGCCATGACACGAGCGACGTCCTCTCGAGAGGACGTCGCTCGTGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030555.1-160s1c1
Sequence:CCGGTGAACTGCCATCGGATGAAGTCTCGAGACTTCATCCGATGGCAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)