EMAIL THIS PAGE TO A FRIEND

PBXIP1

pre-B-cell leukemia homeobox interacting protein 1

56 Gene Product Result for
Synonyms: HPIP
UniProtKB ID: Q96AQ6, Q5T174, Q5T176, Q9H8X6, Q9HA02, Q9HD85
Gene ID:
Mouse(229534) pre B cell leukemia transcription factor interacting protein 1
Rat(310644) pre-B-cell leukemia homeobox interacting protein 1
sheep(101104627) pre-B-cell leukemia homeobox interacting protein 1
domestic guinea pig(100734002) pre-B-cell leukemia homeobox interacting protein 1
naked mole-rat(101718809) pre-B-cell leukemia homeobox interacting protein 1
chicken(100857958) pre-B-cell leukemia homeobox interacting protein 1
cow(506485) pre-B-cell leukemia homeobox interacting protein 1
domestic cat(101096537) pre-B-cell leukemia homeobox interacting protein 1
dog(480133) pre-B-cell leukemia homeobox interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020524 Rosetta Predictions human pricing
NM_001100976 Rosetta Predictions rat pricing
NM_146131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156120 predicted 1134
2 SASI_Hs01_00156123 predicted 2348
3 SASI_Hs01_00156124 predicted 1539
4 SASI_Hs01_00156125 predicted 2341
5 SASI_Hs02_00353567 predicted 1516
6 SASI_Hs02_00353568 predicted 1520
7 SASI_Hs01_00156127 predicted 1999
8 SASI_Hs01_00156128 predicted 273
9 SASI_Hs02_00353569 predicted 863
10 SASI_Hs01_00156129 predicted 2349
11 SASI_Hs01_00156121 predicted 2452
12 SASI_Hs01_00156122 predicted 1537
13 SASI_Hs01_00156126 predicted 2399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210902 predicted 2239
2 SASI_Rn02_00210903 predicted 1352
3 SASI_Rn02_00210904 predicted 787
4 SASI_Rn02_00210905 predicted 1154
5 SASI_Rn02_00210906 predicted 997
6 SASI_Rn02_00210907 predicted 2091
7 SASI_Rn02_00210908 predicted 1632
8 SASI_Rn02_00210909 predicted 350
9 SASI_Rn02_00210910 predicted 2014
10 SASI_Rn02_00210911 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128947 predicted 2014
2 SASI_Mm01_00128949 predicted 2119
3 SASI_Mm01_00128951 predicted 361
4 SASI_Mm01_00128952 predicted 638
5 SASI_Mm01_00128954 predicted 1402
6 SASI_Mm01_00128955 predicted 1634
7 SASI_Mm02_00341812 predicted 203
8 SASI_Mm02_00341813 predicted 300
9 SASI_Mm01_00128956 predicted 776
10 SASI_Mm02_00341814 predicted 1699
11 SASI_Mm01_00128948 predicted 2156
12 SASI_Mm01_00128950 predicted 842
13 SASI_Mm01_00128953 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146131
PBXIP1 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-2132s21c1
Sequence:CCGGATGATGAAGTGGATGACTTTGCTCGAGCAAAGTCATCCACTTCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1214s1c1
Sequence:CCGGCCAGCTTATTGGAGCAGCATACTCGAGTATGCTGCTCCAATAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146131.1-2306s1c1
Sequence:CCGGGCTCAAGATGCCTGGAGTTATCTCGAGATAACTCCAGGCATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-2160s1c1
Sequence:CCGGCCTGAAGAAGAGGTCACGAAACTCGAGTTTCGTGACCTCTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1987s1c1
Sequence:CCGGCCTGCTTACTTTGGAGAAGATCTCGAGATCTTCTCCAAAGTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1652s1c1
Sequence:CCGGCGGACGAATCTGGGAGCAGAACTCGAGTTCTGCTCCCAGATTCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146131.2-2561s21c1
Sequence:CCGGATAAAGGCCCTGGGTACTAAGCTCGAGCTTAGTACCCAGGGCCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-476s21c1
Sequence:CCGGAGATCCATCCACAGAACTTACCTCGAGGTAAGTTCTGTGGATGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-1193s21c1
Sequence:CCGGAGGATGGCAAGGCCACTAAAGCTCGAGCTTTAGTGGCCTTGCCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146131
PBXIP1 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-2132s21c1
Sequence:CCGGATGATGAAGTGGATGACTTTGCTCGAGCAAAGTCATCCACTTCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1214s1c1
Sequence:CCGGCCAGCTTATTGGAGCAGCATACTCGAGTATGCTGCTCCAATAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146131.1-2306s1c1
Sequence:CCGGGCTCAAGATGCCTGGAGTTATCTCGAGATAACTCCAGGCATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-2160s1c1
Sequence:CCGGCCTGAAGAAGAGGTCACGAAACTCGAGTTTCGTGACCTCTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1987s1c1
Sequence:CCGGCCTGCTTACTTTGGAGAAGATCTCGAGATCTTCTCCAAAGTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1652s1c1
Sequence:CCGGCGGACGAATCTGGGAGCAGAACTCGAGTTCTGCTCCCAGATTCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146131.2-2561s21c1
Sequence:CCGGATAAAGGCCCTGGGTACTAAGCTCGAGCTTAGTACCCAGGGCCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-476s21c1
Sequence:CCGGAGATCCATCCACAGAACTTACCTCGAGGTAAGTTCTGTGGATGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-1193s21c1
Sequence:CCGGAGGATGGCAAGGCCACTAAAGCTCGAGCTTTAGTGGCCTTGCCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146131
PBXIP1 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-2132s21c1
Sequence:CCGGATGATGAAGTGGATGACTTTGCTCGAGCAAAGTCATCCACTTCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1214s1c1
Sequence:CCGGCCAGCTTATTGGAGCAGCATACTCGAGTATGCTGCTCCAATAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146131.1-2306s1c1
Sequence:CCGGGCTCAAGATGCCTGGAGTTATCTCGAGATAACTCCAGGCATCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-2160s1c1
Sequence:CCGGCCTGAAGAAGAGGTCACGAAACTCGAGTTTCGTGACCTCTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1987s1c1
Sequence:CCGGCCTGCTTACTTTGGAGAAGATCTCGAGATCTTCTCCAAAGTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146131.1-1652s1c1
Sequence:CCGGCGGACGAATCTGGGAGCAGAACTCGAGTTCTGCTCCCAGATTCGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146131.2-2561s21c1
Sequence:CCGGATAAAGGCCCTGGGTACTAAGCTCGAGCTTAGTACCCAGGGCCTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-476s21c1
Sequence:CCGGAGATCCATCCACAGAACTTACCTCGAGGTAAGTTCTGTGGATGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146131.2-1193s21c1
Sequence:CCGGAGGATGGCAAGGCCACTAAAGCTCGAGCTTTAGTGGCCTTGCCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020524
PBXIP1 MISSION shRNA Bacterial Glycerol Stock
pre-B-cell leukemia homeobox interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1233s1c1
Sequence:CCGGCAGGCATTAAGGCAAGAGTTACTCGAGTAACTCTTGCCTTAATGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1856s1c1
Sequence:CCGGCCTGACTTTCTTTGGCACAGACTCGAGTCTGTGCCAAAGAAAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-206s1c1
Sequence:CCGGGAAAGAATTAGCTGGGACCATCTCGAGATGGTCCCAGCTAATTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-2091s1c1
Sequence:CCGGGATGATGAAGTAGATGACTTTCTCGAGAAAGTCATCTACTTCATCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-629s1c1
Sequence:CCGGGCTGGGCATCTCCCTCAACATCTCGAGATGTTGAGGGAGATGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020524.2-2292s21c1
Sequence:CCGGAGCCCAAGATCCCAGCGTTATCTCGAGATAACGCTGGGATCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1234s21c1
Sequence:CCGGAGGCATTAAGGCAAGAGTTAGCTCGAGCTAACTCTTGCCTTAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-263s21c1
Sequence:CCGGTCAGTCTGGCAGCATTCTAACCTCGAGGTTAGAATGCTGCCAGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-239s21c1
Sequence:CCGGGACGCTCTTCCAGACTGAAAGCTCGAGCTTTCAGTCTGGAAGAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1517s21c1
Sequence:CCGGGGCTGAGCACTGGAAACATAACTCGAGTTATGTTTCCAGTGCTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020524
PBXIP1 MISSION shRNA shRNA Plasmid DNA
pre-B-cell leukemia homeobox interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1233s1c1
Sequence:CCGGCAGGCATTAAGGCAAGAGTTACTCGAGTAACTCTTGCCTTAATGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1856s1c1
Sequence:CCGGCCTGACTTTCTTTGGCACAGACTCGAGTCTGTGCCAAAGAAAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-206s1c1
Sequence:CCGGGAAAGAATTAGCTGGGACCATCTCGAGATGGTCCCAGCTAATTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-2091s1c1
Sequence:CCGGGATGATGAAGTAGATGACTTTCTCGAGAAAGTCATCTACTTCATCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-629s1c1
Sequence:CCGGGCTGGGCATCTCCCTCAACATCTCGAGATGTTGAGGGAGATGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020524.2-2292s21c1
Sequence:CCGGAGCCCAAGATCCCAGCGTTATCTCGAGATAACGCTGGGATCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1234s21c1
Sequence:CCGGAGGCATTAAGGCAAGAGTTAGCTCGAGCTAACTCTTGCCTTAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-263s21c1
Sequence:CCGGTCAGTCTGGCAGCATTCTAACCTCGAGGTTAGAATGCTGCCAGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-239s21c1
Sequence:CCGGGACGCTCTTCCAGACTGAAAGCTCGAGCTTTCAGTCTGGAAGAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1517s21c1
Sequence:CCGGGGCTGAGCACTGGAAACATAACTCGAGTTATGTTTCCAGTGCTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020524
PBXIP1 MISSION shRNA Lentiviral Transduction Particles
pre-B-cell leukemia homeobox interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1233s1c1
Sequence:CCGGCAGGCATTAAGGCAAGAGTTACTCGAGTAACTCTTGCCTTAATGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-1856s1c1
Sequence:CCGGCCTGACTTTCTTTGGCACAGACTCGAGTCTGTGCCAAAGAAAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-206s1c1
Sequence:CCGGGAAAGAATTAGCTGGGACCATCTCGAGATGGTCCCAGCTAATTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-2091s1c1
Sequence:CCGGGATGATGAAGTAGATGACTTTCTCGAGAAAGTCATCTACTTCATCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020524.2-629s1c1
Sequence:CCGGGCTGGGCATCTCCCTCAACATCTCGAGATGTTGAGGGAGATGCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020524.2-2292s21c1
Sequence:CCGGAGCCCAAGATCCCAGCGTTATCTCGAGATAACGCTGGGATCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1234s21c1
Sequence:CCGGAGGCATTAAGGCAAGAGTTAGCTCGAGCTAACTCTTGCCTTAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-263s21c1
Sequence:CCGGTCAGTCTGGCAGCATTCTAACCTCGAGGTTAGAATGCTGCCAGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-239s21c1
Sequence:CCGGGACGCTCTTCCAGACTGAAAGCTCGAGCTTTCAGTCTGGAAGAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020524.2-1517s21c1
Sequence:CCGGGGCTGAGCACTGGAAACATAACTCGAGTTATGTTTCCAGTGCTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)