EMAIL THIS PAGE TO A FRIEND

PC

pyruvate carboxylase

58 Gene Product Result for
Synonyms: PCB
UniProtKB ID: P11498, Q16705
Gene ID:
Human(5091) Summary: This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18517) phocomelic
Rat(25104) pyruvate carboxylase
fruit fly(40358) Polycomb
cow(102030714) Milk protein content
cow(102030715) Milk protein content
cow(102030716) Milk protein content
cow(102030897) Milk protein content
cow(102030982) Milk protein content
cow(102031061) Milk protein content
cow(102030942) Milk protein content
cow(338471) pyruvate carboxylase
cow(100531427) Milk protein content
Horse(100052853) pyruvate carboxylase
domestic cat(101089547) pyruvate carboxylase
dog(483704) pyruvate carboxylase
chicken(374263) pyruvate carboxylase
Zebrafish(58068) pyruvate carboxylase
naked mole-rat(101711800) pyruvate carboxylase
domestic guinea pig(100719498) pyruvate carboxylase
Goat(100861129) pyruvate carboxylase
sheep(101107484) pyruvate carboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000920 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134851 MISSION® esiRNA esiRNA human PC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000920 Rosetta Predictions human pricing
NM_001040716 Rosetta Predictions human pricing
NM_022172 Rosetta Predictions human pricing
NM_012744 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054632 predicted 2231
2 SASI_Hs01_00054633 predicted 320
3 SASI_Hs01_00054634 predicted 3368
4 SASI_Hs01_00054635 predicted 2616
5 SASI_Hs01_00054636 predicted 984
6 SASI_Hs01_00054637 predicted 1048
7 SASI_Hs01_00054638 predicted 970
8 SASI_Hs02_00303496 predicted 329
9 SASI_Hs01_00054639 predicted 1717
10 SASI_Hs02_00303497 predicted 1463
11 SASI_Hs01_00054640 predicted 2166
12 SASI_Hs01_00054641 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309149 predicted 2421
2 SASI_Hs02_00309150 predicted 511
3 SASI_Hs02_00309151 predicted 3557
4 SASI_Hs02_00309152 predicted 2806
5 SASI_Hs02_00309153 predicted 1175
6 SASI_Hs02_00309154 predicted 1230
7 SASI_Hs02_00309155 predicted 1163
8 SASI_Hs02_00309156 predicted 511
9 SASI_Hs02_00309157 predicted 1902
10 SASI_Hs02_00309158 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166364 predicted 2188
2 SASI_Hs01_00166365 predicted 280
3 SASI_Hs01_00166366 predicted 3325
4 SASI_Hs01_00166367 predicted 2571
5 SASI_Hs01_00166368 predicted 938
6 SASI_Hs01_00166369 predicted 1001
7 SASI_Hs01_00166370 predicted 928
8 SASI_Hs02_00355607 predicted 287
9 SASI_Hs01_00166371 predicted 1664
10 SASI_Hs02_00355608 predicted 1412
11 SASI_Hs01_00166372 predicted 2100
12 SASI_Hs01_00166373 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101243 predicted 1162
2 SASI_Rn01_00101244 predicted 1020
3 SASI_Rn02_00260097 predicted 829
4 SASI_Rn01_00101245 predicted 3585
5 SASI_Rn01_00101247 predicted 2455
6 SASI_Rn02_00260098 predicted 2115
7 SASI_Rn01_00101248 predicted 3091
8 SASI_Rn01_00101249 predicted 3342
9 SASI_Rn01_00101250 predicted 3307
10 SASI_Rn01_00101251 predicted 919
11 SASI_Rn01_00101246 predicted 3164
12 SASI_Rn01_00101252 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000920
PC MISSION shRNA Bacterial Glycerol Stock
pyruvate carboxylase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-192s21c1
Sequence:CCGGAGTATAAGCCCATCAAGAAAGCTCGAGCTTTCTTGATGGGCTTATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-1301s21c1
Sequence:CCGGATGGGCATCCGCCTGGATAATCTCGAGATTATCCAGGCGGATGCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-1080s1c1
Sequence:CCGGCGACTCTGTGAAACTCGCTAACTCGAGTTAGCGAGTTTCACAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-517s1c1
Sequence:CCGGGCCAAGGAGAACAACGTAGATCTCGAGATCTACGTTGTTCTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000920.2-3939s1c1
Sequence:CCGGCATGTTCATCTCTTGCCAAATCTCGAGATTTGGCAAGAGATGAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2953s1c1
Sequence:CCGGGCCCAGTTTATGGTGCAGAATCTCGAGATTCTGCACCATAAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2238s1c1
Sequence:CCGGCCTCAACTACTTGCCCAACATCTCGAGATGTTGGGCAAGTAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-906s21c1
Sequence:CCGGACCAGAAGGTGGTCGAGATTGCTCGAGCAATCTCGACCACCTTCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000920
PC MISSION shRNA shRNA Plasmid DNA
pyruvate carboxylase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-192s21c1
Sequence:CCGGAGTATAAGCCCATCAAGAAAGCTCGAGCTTTCTTGATGGGCTTATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-1301s21c1
Sequence:CCGGATGGGCATCCGCCTGGATAATCTCGAGATTATCCAGGCGGATGCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-1080s1c1
Sequence:CCGGCGACTCTGTGAAACTCGCTAACTCGAGTTAGCGAGTTTCACAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-517s1c1
Sequence:CCGGGCCAAGGAGAACAACGTAGATCTCGAGATCTACGTTGTTCTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000920.2-3939s1c1
Sequence:CCGGCATGTTCATCTCTTGCCAAATCTCGAGATTTGGCAAGAGATGAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2953s1c1
Sequence:CCGGGCCCAGTTTATGGTGCAGAATCTCGAGATTCTGCACCATAAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2238s1c1
Sequence:CCGGCCTCAACTACTTGCCCAACATCTCGAGATGTTGGGCAAGTAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-906s21c1
Sequence:CCGGACCAGAAGGTGGTCGAGATTGCTCGAGCAATCTCGACCACCTTCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000920
PC MISSION shRNA Lentiviral Transduction Particles
pyruvate carboxylase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-192s21c1
Sequence:CCGGAGTATAAGCCCATCAAGAAAGCTCGAGCTTTCTTGATGGGCTTATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-1301s21c1
Sequence:CCGGATGGGCATCCGCCTGGATAATCTCGAGATTATCCAGGCGGATGCCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-1080s1c1
Sequence:CCGGCGACTCTGTGAAACTCGCTAACTCGAGTTAGCGAGTTTCACAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-517s1c1
Sequence:CCGGGCCAAGGAGAACAACGTAGATCTCGAGATCTACGTTGTTCTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000920.2-3939s1c1
Sequence:CCGGCATGTTCATCTCTTGCCAAATCTCGAGATTTGGCAAGAGATGAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2953s1c1
Sequence:CCGGGCCCAGTTTATGGTGCAGAATCTCGAGATTCTGCACCATAAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000920.2-2238s1c1
Sequence:CCGGCCTCAACTACTTGCCCAACATCTCGAGATGTTGGGCAAGTAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000920.3-906s21c1
Sequence:CCGGACCAGAAGGTGGTCGAGATTGCTCGAGCAATCTCGACCACCTTCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)