EMAIL THIS PAGE TO A FRIEND

PCAT4

prostate cancer associated transcript 4 (non-protein coding)

2 Gene Product Result for
Synonyms: GDEP PCA4 PCAN1
Species: Human PCAT4(118425)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058168 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058168
PCAT4 MISSION shRNA Bacterial Glycerol Stock
prostate cancer associated transcript 4 (non-protein coding)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-266s1c1
Sequence:CCGGGCTTGAATCCTGTCAGTCCTACTCGAGTAGGACTGACAGGATTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-97s1c1
Sequence:CCGGGAAACATGGATGGCCTTGGGACTCGAGTCCCAAGGCCATCCATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-163s1c1
Sequence:CCGGGCTATTTATGACCATGTCATTCTCGAGAATGACATGGTCATAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-83s1c1
Sequence:CCGGGAGTGAGGAACTGAGAAACATCTCGAGATGTTTCTCAGTTCCTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-281s1c1
Sequence:CCGGGTCCTATACTGGAGTCCTGTTCTCGAGAACAGGACTCCAGTATAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-151s1c1
Sequence:CCGGGAACTCAAGGAGGCTATTTATCTCGAGATAAATAGCCTCCTTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-195s1c1
Sequence:CCGGGAAAGCTTATCTGGAGTGAAACTCGAGTTTCACTCCAGATAAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-216s1c1
Sequence:CCGGGTAAATGAGACCAACAGAGATCTCGAGATCTCTGTTGGTCTCATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-87s1c1
Sequence:CCGGGAGGAACTGAGAAACATGGATCTCGAGATCCATGTTTCTCAGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-232s1c1
Sequence:CCGGGAGATAAGAGACCCGGAGAAACTCGAGTTTCTCCGGGTCTCTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-245s1c1
Sequence:CCGGCGGAGAAATCCTGGTTACACTCTCGAGAGTGTAACCAGGATTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-249s1c1
Sequence:CCGGGAAATCCTGGTTACACTGCTTCTCGAGAAGCAGTGTAACCAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-174s1c1
Sequence:CCGGCCATGTCATTTGCAACATGAACTCGAGTTCATGTTGCAAATGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058168
PCAT4 MISSION shRNA shRNA Plasmid DNA
prostate cancer associated transcript 4 (non-protein coding)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-266s1c1
Sequence:CCGGGCTTGAATCCTGTCAGTCCTACTCGAGTAGGACTGACAGGATTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-97s1c1
Sequence:CCGGGAAACATGGATGGCCTTGGGACTCGAGTCCCAAGGCCATCCATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-163s1c1
Sequence:CCGGGCTATTTATGACCATGTCATTCTCGAGAATGACATGGTCATAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-83s1c1
Sequence:CCGGGAGTGAGGAACTGAGAAACATCTCGAGATGTTTCTCAGTTCCTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-281s1c1
Sequence:CCGGGTCCTATACTGGAGTCCTGTTCTCGAGAACAGGACTCCAGTATAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-151s1c1
Sequence:CCGGGAACTCAAGGAGGCTATTTATCTCGAGATAAATAGCCTCCTTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-195s1c1
Sequence:CCGGGAAAGCTTATCTGGAGTGAAACTCGAGTTTCACTCCAGATAAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-216s1c1
Sequence:CCGGGTAAATGAGACCAACAGAGATCTCGAGATCTCTGTTGGTCTCATTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-87s1c1
Sequence:CCGGGAGGAACTGAGAAACATGGATCTCGAGATCCATGTTTCTCAGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-232s1c1
Sequence:CCGGGAGATAAGAGACCCGGAGAAACTCGAGTTTCTCCGGGTCTCTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-245s1c1
Sequence:CCGGCGGAGAAATCCTGGTTACACTCTCGAGAGTGTAACCAGGATTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-249s1c1
Sequence:CCGGGAAATCCTGGTTACACTGCTTCTCGAGAAGCAGTGTAACCAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-174s1c1
Sequence:CCGGCCATGTCATTTGCAACATGAACTCGAGTTCATGTTGCAAATGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058168
PCAT4 MISSION shRNA Lentiviral Transduction Particles
prostate cancer associated transcript 4 (non-protein coding)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-266s1c1
Sequence:CCGGGCTTGAATCCTGTCAGTCCTACTCGAGTAGGACTGACAGGATTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-97s1c1
Sequence:CCGGGAAACATGGATGGCCTTGGGACTCGAGTCCCAAGGCCATCCATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-163s1c1
Sequence:CCGGGCTATTTATGACCATGTCATTCTCGAGAATGACATGGTCATAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-83s1c1
Sequence:CCGGGAGTGAGGAACTGAGAAACATCTCGAGATGTTTCTCAGTTCCTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-281s1c1
Sequence:CCGGGTCCTATACTGGAGTCCTGTTCTCGAGAACAGGACTCCAGTATAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-151s1c1
Sequence:CCGGGAACTCAAGGAGGCTATTTATCTCGAGATAAATAGCCTCCTTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-195s1c1
Sequence:CCGGGAAAGCTTATCTGGAGTGAAACTCGAGTTTCACTCCAGATAAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-216s1c1
Sequence:CCGGGTAAATGAGACCAACAGAGATCTCGAGATCTCTGTTGGTCTCATTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058168.2-87s1c1
Sequence:CCGGGAGGAACTGAGAAACATGGATCTCGAGATCCATGTTTCTCAGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-232s1c1
Sequence:CCGGGAGATAAGAGACCCGGAGAAACTCGAGTTTCTCCGGGTCTCTTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-245s1c1
Sequence:CCGGCGGAGAAATCCTGGTTACACTCTCGAGAGTGTAACCAGGATTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-249s1c1
Sequence:CCGGGAAATCCTGGTTACACTGCTTCTCGAGAAGCAGTGTAACCAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058168.2-174s1c1
Sequence:CCGGCCATGTCATTTGCAACATGAACTCGAGTTCATGTTGCAAATGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)