EMAIL THIS PAGE TO A FRIEND

PCBD1

pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha

41 Gene Product Result for
Synonyms: DCOH PCBD PCD PHS
UniProtKB ID: P61457, P70519, P80095, Q9D930
Gene ID:
Human(5092) Summary: This gene encodes pterin-4 alpha-carbinolamine dehydratase, an enzyme involved in phenylalanine hydroxylation. A deficiency of this enzyme leads to hyperphenylalaninemia. The enzyme regulates the homodimerization of the transcription factor hepatocyte nuclear factor 1 (HNF1). [provided by RefSeq, Jul 2008]
Mouse(13180) pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1
Rat(29700) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Zebrafish(393787) 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)
chicken(395729) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
cow(530736) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
dog(609680) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
domestic cat(101100920) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
sheep(101106822) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
domestic guinea pig(100722830) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
naked mole-rat(101719124) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164631 MISSION® esiRNA esiRNA targeting mouse Pcbd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000281 Rosetta Predictions human pricing
NM_001007601 Rosetta Predictions rat pricing
NM_025273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103724 predicted 443
2 SASI_Hs01_00103725 predicted 485
3 SASI_Hs01_00103726 predicted 536
4 SASI_Hs01_00103727 predicted 435
5 SASI_Hs01_00103728 predicted 440
6 SASI_Hs01_00103729 predicted 521
7 SASI_Hs01_00103730 predicted 502
8 SASI_Hs01_00103731 predicted 780
9 SASI_Hs01_00103732 predicted 430
10 SASI_Hs01_00103733 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051168 predicted 211
2 SASI_Rn01_00051169 predicted 248
3 SASI_Rn01_00051171 predicted 297
4 SASI_Rn01_00051172 predicted 223
5 SASI_Rn01_00051173 predicted 254
6 SASI_Rn01_00051174 predicted 308
7 SASI_Rn02_00198677 predicted 516
8 SASI_Rn01_00051175 predicted 325
9 SASI_Rn01_00051176 predicted 203
10 SASI_Rn02_00198678 predicted 469
11 SASI_Rn01_00051170 predicted 423
12 SASI_Rn01_00051177 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184119 predicted 569
2 SASI_Mm01_00184120 predicted 321
3 SASI_Mm01_00184121 predicted 304
4 SASI_Mm01_00184122 predicted 248
5 SASI_Mm01_00184123 predicted 284
6 SASI_Mm01_00184124 predicted 487
7 SASI_Mm01_00184125 predicted 220
8 SASI_Mm01_00184126 predicted 370
9 SASI_Mm01_00184127 predicted 568
10 SASI_Mm01_00184128 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000281
VALIDATED
PCBD1 MISSION shRNA Bacterial Glycerol Stock
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-528s21c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-420s21c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-502s21c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-140s1c1
Sequence:CCGGCAAAGACTTCAACAGGGCCTTCTCGAGAAGGCCCTGTTGAAGTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-297s1c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-271s1c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-224s1c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000281.2-455s21c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-189s1c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000281
VALIDATED
PCBD1 MISSION shRNA shRNA Plasmid DNA
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-528s21c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-420s21c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-502s21c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-140s1c1
Sequence:CCGGCAAAGACTTCAACAGGGCCTTCTCGAGAAGGCCCTGTTGAAGTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-297s1c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-271s1c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-224s1c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000281.2-455s21c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-189s1c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000281
VALIDATED
PCBD1 MISSION shRNA Lentiviral Transduction Particles
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-528s21c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-420s21c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000281.2-502s21c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-140s1c1
Sequence:CCGGCAAAGACTTCAACAGGGCCTTCTCGAGAAGGCCCTGTTGAAGTCTTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-297s1c1
Sequence:CCGGGCCAGCTTCATCGAACAAGTACTCGAGTACTTGTTCGATGAAGCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-271s1c1
Sequence:CCGGGCCTTTCAGAACGGGACATAACTCGAGTTATGTCCCGTTCTGAAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-224s1c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000281.2-455s21c1
Sequence:CCGGCGTGTACAACAAGGTCCACATCTCGAGATGTGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000281.1-189s1c1
Sequence:CCGGGCTGAGAAACTGGACCACCATCTCGAGATGGTGGTCCAGTTTCTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025273
PCBD1 MISSION shRNA Bacterial Glycerol Stock
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025273.1-559s1c1
Sequence:CCGGGCCATGTTACACTAATTTGAACTCGAGTTCAAATTAGTGTAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-306s1c1
Sequence:CCGGGTCTTTCGGAACGGGATATAACTCGAGTTATATCCCGTTCCGAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-152s1c1
Sequence:CCGGGCTATCTTCAAGCAGTTCCATCTCGAGATGGAACTGCTTGAAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-247s1c1
Sequence:CCGGCGAGTGGTTTAACGTGTACAACTCGAGTTGTACACGTTAAACCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-259s1c1
Sequence:CCGGCGTGTACAACAAGGTCCATATCTCGAGATATGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025273
PCBD1 MISSION shRNA shRNA Plasmid DNA
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025273.1-559s1c1
Sequence:CCGGGCCATGTTACACTAATTTGAACTCGAGTTCAAATTAGTGTAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-306s1c1
Sequence:CCGGGTCTTTCGGAACGGGATATAACTCGAGTTATATCCCGTTCCGAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-152s1c1
Sequence:CCGGGCTATCTTCAAGCAGTTCCATCTCGAGATGGAACTGCTTGAAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-247s1c1
Sequence:CCGGCGAGTGGTTTAACGTGTACAACTCGAGTTGTACACGTTAAACCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-259s1c1
Sequence:CCGGCGTGTACAACAAGGTCCATATCTCGAGATATGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025273
PCBD1 MISSION shRNA Lentiviral Transduction Particles
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025273.1-559s1c1
Sequence:CCGGGCCATGTTACACTAATTTGAACTCGAGTTCAAATTAGTGTAACATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-306s1c1
Sequence:CCGGGTCTTTCGGAACGGGATATAACTCGAGTTATATCCCGTTCCGAAAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-152s1c1
Sequence:CCGGGCTATCTTCAAGCAGTTCCATCTCGAGATGGAACTGCTTGAAGATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-247s1c1
Sequence:CCGGCGAGTGGTTTAACGTGTACAACTCGAGTTGTACACGTTAAACCACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025273.1-259s1c1
Sequence:CCGGCGTGTACAACAAGGTCCATATCTCGAGATATGGACCTTGTTGTACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)