EMAIL THIS PAGE TO A FRIEND

PCBP1

poly(rC) binding protein 1

84 Gene Product Result for
Synonyms: HNRPE1 HNRPX hnRNP-E1 hnRNP-X
UniProtKB ID: Q15365, Q13157, Q14975
Gene ID:
Human(5093) Summary: This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
Mouse(23983) poly(rC) binding protein 1
Rat(500242) poly(rC) binding protein 1
Horse(100050579) poly(rC) binding protein 1
dog(481417) poly(rC) binding protein 1
domestic cat(101095571) poly(rC) binding protein 1
cow(509917) poly(rC) binding protein 1
sheep(101106505) poly(rC) binding protein 1
domestic guinea pig(100726474) poly(rC) binding protein 1
naked mole-rat(101726771) poly(rC) binding protein 1
Domestic Rabbit(100008848) poly(rC) binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R4030 Anti-hnRNP-E1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunoprecipitation (IP), western blot pricing
R4155 Anti-hnRNP-E1/E2 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunoprecipitation (IP), western blot pricing
SAB2108532 Anti-PCBP1 affinity isolated antibody mouse, canine, canine, rabbit, bovine, horse, human, guinea pig
immunohistochemistry, western blot pricing
SAB2501515 Anti-PCBP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, canine, mouse, human, rat
ELISA, western blot pricing
SAB2501516 Anti-PCBP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, western blot pricing
AV40631 Anti-PCBP1 antibody produced in rabbit affinity isolated antibody mouse, bovine, horse, rat, rabbit, rabbit, guinea pig, human, canine
western blot pricing
AV40630 Anti-PCBP1 antibody produced in rabbit IgG fraction of antiserum bovine, horse, mouse, rabbit, human, rat, rabbit, guinea pig
western blot pricing
HPA043803 Anti-PCBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
HPA068497 Anti-PCBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
WH0005093M1 Monoclonal Anti-PCBP1 antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011551 MISSION® esiRNA esiRNA targeting mouse Pcbp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006196 Rosetta Predictions human pricing
XM_575592 Rosetta Predictions rat pricing
XR_008964 Rosetta Predictions rat pricing
NM_011865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034329 predicted 272
2 SASI_Hs01_00034330 predicted 1171
3 SASI_Hs01_00034331 predicted 705
4 SASI_Hs01_00034332 predicted 857
5 SASI_Hs01_00034333 predicted 371
6 SASI_Hs01_00034334 predicted 520
7 SASI_Hs01_00034335 predicted 858
8 SASI_Hs01_00034337 predicted 985
9 SASI_Hs01_00034338 predicted 338
10 SASI_Hs02_00341086 predicted 1173
11 SASI_Hs01_00034336 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403853 predicted 711
2 SASI_Rn02_00403854 predicted 716
3 SASI_Rn02_00403855 predicted 747
4 SASI_Rn02_00403856 predicted 286
5 SASI_Rn02_00403857 predicted 1063
6 SASI_Rn02_00403858 predicted 737
7 SASI_Rn02_00403859 predicted 587
8 SASI_Rn02_00403860 predicted 817
9 SASI_Rn02_00403861 predicted 1061
10 SASI_Rn02_00403862 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180309 predicted 679
2 SASI_Rn01_00180310 predicted 684
3 SASI_Rn01_00180311 predicted 708
4 SASI_Rn01_00180312 predicted 254
5 SASI_Rn01_00180313 predicted 1030
6 SASI_Rn01_00180314 predicted 712
7 SASI_Rn01_00180315 predicted 551
8 SASI_Rn01_00180316 predicted 788
9 SASI_Rn02_00418361 predicted 1026
10 SASI_Rn02_00418362 predicted 689
11 SASI_Rn01_00180317 predicted 982
12 SASI_Rn01_00180318 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177171 predicted 911
2 SASI_Mm01_00177173 predicted 1098
3 SASI_Mm01_00177174 predicted 362
4 SASI_Mm01_00177175 predicted 945
5 SASI_Mm01_00177179 predicted 940
6 SASI_Mm01_00177180 predicted 1019
7 SASI_Mm02_00321638 predicted 972
8 SASI_Mm02_00321639 predicted 424
9 SASI_Mm02_00321640 predicted 1109
10 SASI_Mm02_00321641 predicted 978
11 SASI_Mm01_00177172 predicted 787
12 SASI_Mm01_00177176 predicted 488
13 SASI_Mm01_00177177 predicted 1265
14 SASI_Mm01_00177178 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006196
VALIDATED
PCBP1 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-1289s1c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-376s1c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006196.2-225s1c1
Sequence:CCGGTCGGCTTCTTATGCACGGAAACTCGAGTTTCCGTGCATAAGAAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-838s1c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-525s1c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1299s21c1
Sequence:CCGGTAGTCTGGCCCAGTATCTAATCTCGAGATTAGATACTGGGCCAGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-952s21c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1403s21c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-490s21c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-639s21c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006196
VALIDATED
PCBP1 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-1289s1c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-376s1c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006196.2-225s1c1
Sequence:CCGGTCGGCTTCTTATGCACGGAAACTCGAGTTTCCGTGCATAAGAAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-838s1c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-525s1c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1299s21c1
Sequence:CCGGTAGTCTGGCCCAGTATCTAATCTCGAGATTAGATACTGGGCCAGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-952s21c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1403s21c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-490s21c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-639s21c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006196
VALIDATED
PCBP1 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-1289s1c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-376s1c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006196.2-225s1c1
Sequence:CCGGTCGGCTTCTTATGCACGGAAACTCGAGTTTCCGTGCATAAGAAGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-838s1c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006196.2-525s1c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1299s21c1
Sequence:CCGGTAGTCTGGCCCAGTATCTAATCTCGAGATTAGATACTGGGCCAGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-952s21c1
Sequence:CCGGGCCTACTCGATTCAAGGACAACTCGAGTTGTCCTTGAATCGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-1403s21c1
Sequence:CCGGCCCATGATCCAACTGTGTAATCTCGAGATTACACAGTTGGATCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-490s21c1
Sequence:CCGGGCCATCTTTAAGGCTTTCGCTCTCGAGAGCGAAAGCCTTAAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006196.3-639s21c1
Sequence:CCGGCGGGTGTAAGATCAAAGAGATCTCGAGATCTCTTTGATCTTACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011865
VALIDATED
PCBP1 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1374s1c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1105s1c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1273s1c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-986s1c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-451s1c1
Sequence:CCGGGCCTACCAATGCCATCTTTAACTCGAGTTAAAGATGGCATTGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1105s21c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1273s21c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011865.3-1374s21c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-986s21c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011865
VALIDATED
PCBP1 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1374s1c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1105s1c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1273s1c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-986s1c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-451s1c1
Sequence:CCGGGCCTACCAATGCCATCTTTAACTCGAGTTAAAGATGGCATTGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1105s21c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1273s21c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011865.3-1374s21c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-986s21c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011865
VALIDATED
PCBP1 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1374s1c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1105s1c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-1273s1c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-986s1c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011865.3-451s1c1
Sequence:CCGGGCCTACCAATGCCATCTTTAACTCGAGTTAAAGATGGCATTGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1105s21c1
Sequence:CCGGCCATGAACTCACCATTCCAAACTCGAGTTTGGAATGGTGAGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-1273s21c1
Sequence:CCGGCCTGGCCCAGTATCTAATCAACTCGAGTTGATTAGATACTGGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011865.3-1374s21c1
Sequence:CCGGCCATGATCCAACTGTGTAATTCTCGAGAATTACACAGTTGGATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011865.3-986s21c1
Sequence:CCGGGCAAGACAACAGTCTCACTTTCTCGAGAAAGTGAGACTGTTGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)