EMAIL THIS PAGE TO A FRIEND

PCBP2

poly(rC) binding protein 2

169 Gene Product Result for
Synonyms: HNRNPE2 HNRPE2 hnRNP-E2
Gene ID:
Human(5094) Summary: The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18521) poly(rC) binding protein 2
Rat(363005) poly(rC) binding protein 2
Zebrafish(321844) poly(rC) binding protein 2
Horse(100062163) poly(rC) binding protein 2
domestic cat(101086733) poly(rC) binding protein 2
dog(477596) poly(rC) binding protein 2
naked mole-rat(101702918) poly(rC) binding protein 2
domestic guinea pig(100731593) poly(rC) binding protein 2
cow(540653) poly(rC) binding protein 2
sheep(101103142) poly(rC) binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005016 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030041 MISSION® esiRNA esiRNA targeting mouse Pcbp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098620 Rosetta Predictions human pricing
NM_005016 Rosetta Predictions human pricing
NM_031989 Rosetta Predictions human pricing
NM_001013223 Rosetta Predictions rat pricing
NM_001103165 Rosetta Predictions mouse pricing
NM_001103166 Rosetta Predictions mouse pricing
NM_011042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319506 predicted 524
2 SASI_Hs02_00319507 predicted 1260
3 SASI_Hs02_00319508 predicted 1210
4 SASI_Hs02_00319509 predicted 1272
5 SASI_Hs02_00319510 predicted 1226
6 SASI_Hs02_00319511 predicted 576
7 SASI_Hs02_00319512 predicted 1231
8 SASI_Hs02_00319513 predicted 1220
9 SASI_Hs02_00319514 predicted 1339
10 SASI_Hs02_00319515 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082600 predicted 530
2 SASI_Hs01_00082601 predicted 1369
3 SASI_Hs01_00082602 predicted 1308
4 SASI_Hs02_00338786 predicted 1382
5 SASI_Hs01_00082604 predicted 1336
6 SASI_Hs01_00082605 predicted 579
7 SASI_Hs01_00082606 predicted 1336
8 SASI_Hs01_00082607 predicted 1322
9 SASI_Hs02_00338787 predicted 1444
10 SASI_Hs01_00082608 predicted 472
11 SASI_Hs01_00082599 predicted 1218
12 SASI_Hs01_00082603 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105675 predicted 523
2 SASI_Hs01_00105676 predicted 1357
3 SASI_Hs01_00105677 predicted 1304
4 SASI_Hs02_00359173 predicted 1371
5 SASI_Hs01_00105679 predicted 1321
6 SASI_Hs01_00105680 predicted 583
7 SASI_Hs01_00105681 predicted 1327
8 SASI_Hs01_00105682 predicted 1315
9 SASI_Hs02_00359174 predicted 1428
10 SASI_Hs01_00105683 predicted 475
11 SASI_Hs01_00105674 predicted 1209
12 SASI_Hs01_00105678 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115822 predicted 915
2 SASI_Rn01_00115823 predicted 1261
3 SASI_Rn01_00115824 predicted 633
4 SASI_Rn01_00115825 predicted 654
5 SASI_Rn01_00115826 predicted 318
6 SASI_Rn01_00115827 predicted 1249
7 SASI_Rn02_00201025 predicted 1008
8 SASI_Rn01_00115830 predicted 578
9 SASI_Rn02_00201026 predicted 1104
10 SASI_Rn01_00115831 predicted 461
11 SASI_Rn01_00115828 predicted 905
12 SASI_Rn01_00115829 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303134 predicted 1266
2 SASI_Mm02_00303135 predicted 447
3 SASI_Mm02_00303136 predicted 397
4 SASI_Mm02_00303137 predicted 395
5 SASI_Mm02_00303138 predicted 434
6 SASI_Mm02_00303139 predicted 562
7 SASI_Mm02_00303140 predicted 393
8 SASI_Mm02_00303141 predicted 485
9 SASI_Mm02_00303142 predicted 481
10 SASI_Mm02_00303143 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303144 predicted 1178
2 SASI_Mm02_00303145 predicted 455
3 SASI_Mm02_00303146 predicted 390
4 SASI_Mm02_00303147 predicted 396
5 SASI_Mm02_00303148 predicted 426
6 SASI_Mm02_00303149 predicted 555
7 SASI_Mm02_00303150 predicted 392
8 SASI_Mm02_00303151 predicted 478
9 SASI_Mm02_00303152 predicted 479
10 SASI_Mm02_00303153 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319783 predicted 1227
2 SASI_Mm02_00319784 predicted 451
3 SASI_Mm02_00319785 predicted 390
4 SASI_Mm02_00319786 predicted 394
5 SASI_Mm02_00319787 predicted 431
6 SASI_Mm02_00319788 predicted 563
7 SASI_Mm02_00319789 predicted 391
8 SASI_Mm02_00319790 predicted 478
9 SASI_Mm01_00181828 predicted 486
10 SASI_Mm02_00319791 predicted 1290
11 SASI_Mm01_00181824 predicted 329
12 SASI_Mm01_00181825 predicted 909
13 SASI_Mm01_00181826 predicted 586
14 SASI_Mm01_00181827 predicted 888
15 SASI_Mm01_00181829 predicted 359
16 SASI_Mm01_00181830 predicted 1158
17 SASI_Mm01_00181831 predicted 294
18 SASI_Mm01_00181832 predicted 634
19 SASI_Mm01_00181833 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005016
VALIDATED
PCBP2 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005016.5-1022s21c1
Sequence:CCGGACCACCTCTAGAGGCCTATACCTCGAGGTATAGGCCTCTAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005016.3-1488s1c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-530s1c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005016.3-1127s1c1
Sequence:CCGGACCGGATTCAGTGGCATTGAACTCGAGTTCAATGCCACTGAATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-1378s1c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-773s1c1
Sequence:CCGGGCCATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-799s21c1
Sequence:CCGGGCATTCCACAATCCATCATTGCTCGAGCAATGATGGATTGTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1388s21c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-540s21c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1498s21c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005016
VALIDATED
PCBP2 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005016.5-1022s21c1
Sequence:CCGGACCACCTCTAGAGGCCTATACCTCGAGGTATAGGCCTCTAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005016.3-1488s1c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-530s1c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005016.3-1127s1c1
Sequence:CCGGACCGGATTCAGTGGCATTGAACTCGAGTTCAATGCCACTGAATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-1378s1c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-773s1c1
Sequence:CCGGGCCATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-799s21c1
Sequence:CCGGGCATTCCACAATCCATCATTGCTCGAGCAATGATGGATTGTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1388s21c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-540s21c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1498s21c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005016
VALIDATED
PCBP2 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005016.5-1022s21c1
Sequence:CCGGACCACCTCTAGAGGCCTATACCTCGAGGTATAGGCCTCTAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005016.3-1488s1c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-530s1c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005016.3-1127s1c1
Sequence:CCGGACCGGATTCAGTGGCATTGAACTCGAGTTCAATGCCACTGAATCCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-1378s1c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005016.3-773s1c1
Sequence:CCGGGCCATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-799s21c1
Sequence:CCGGGCATTCCACAATCCATCATTGCTCGAGCAATGATGGATTGTGGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1388s21c1
Sequence:CCGGCCTGGCTCAATATCTAATCAACTCGAGTTGATTAGATATTGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-540s21c1
Sequence:CCGGCCCACTAATGCCATCTTCAAACTCGAGTTTGAAGATGGCATTAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005016.5-1498s21c1
Sequence:CCGGCCATGATCCATCTGTGTAGTTCTCGAGAACTACACAGATGGATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011042
VALIDATED
PCBP2 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-654s1c1
Sequence:CCGGGCAATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-472s1c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-354s1c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-383s1c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-1283s1c1
Sequence:CCGGCCCATCCATAATCCTGCTGTTCTCGAGAACAGCAGGATTATGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-563s21c1
Sequence:CCGGTAGTCAGTGTGGCTCTCTTATCTCGAGATAAGAGAGCCACACTGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-980s21c1
Sequence:CCGGGGCAATGCAACAGTCTCATTTCTCGAGAAATGAGACTGTTGCATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-407s21c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-496s21c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-378s21c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011042
VALIDATED
PCBP2 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-654s1c1
Sequence:CCGGGCAATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-472s1c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-354s1c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-383s1c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-1283s1c1
Sequence:CCGGCCCATCCATAATCCTGCTGTTCTCGAGAACAGCAGGATTATGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-563s21c1
Sequence:CCGGTAGTCAGTGTGGCTCTCTTATCTCGAGATAAGAGAGCCACACTGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-980s21c1
Sequence:CCGGGGCAATGCAACAGTCTCATTTCTCGAGAAATGAGACTGTTGCATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-407s21c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-496s21c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-378s21c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011042
VALIDATED
PCBP2 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-654s1c1
Sequence:CCGGGCAATCACTATTGCTGGCATTCTCGAGAATGCCAGCAATAGTGATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-472s1c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011042.1-354s1c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-383s1c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011042.1-1283s1c1
Sequence:CCGGCCCATCCATAATCCTGCTGTTCTCGAGAACAGCAGGATTATGGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-563s21c1
Sequence:CCGGTAGTCAGTGTGGCTCTCTTATCTCGAGATAAGAGAGCCACACTGACTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-980s21c1
Sequence:CCGGGGCAATGCAACAGTCTCATTTCTCGAGAAATGAGACTGTTGCATTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-407s21c1
Sequence:CCGGTCCTGAGAGAATTATCACTTTCTCGAGAAAGTGATAATTCTCTCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-496s21c1
Sequence:CCGGGCAGCTCTATGACCAATAGTACTCGAGTACTATTGGTCATAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011042.2-378s21c1
Sequence:CCGGGCACGTATCAACATCTCAGAACTCGAGTTCTGAGATGTTGATACGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)